JFIF,,,Photoshop 3.08BIM,,http://ns.adobe.com/xap/1.0/ image/jpeg SELLO EMPRESA COMPROMETIDA CON EL EMPLEO JUVENIL 2016-08-19T10:38:52+02:00 2016-08-19T08:38:54Z 2016-08-19T10:38:52+02:00 Adobe Illustrator CC 2015 (Windows) 256 204 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAzAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYq7FXYq7FVlxcQW8Dz3EiwwRKXklchVVRuSSdgMBNMoxMjQFkvGPO3/ORVpaSyWXlW3W8kWqtq NwCIa/8AFcY4s/8ArEgexGY89R3PWdn+y8pASznh/ojn8T0eNa/5382a/I76tqlxcq/WDmUhHyiT jGPuzHlInm9Xpuz8GAeiAHn1+fNMfy//ADH1zyfqUclvK82luw+uaexJjdSfiZAdlfwYfTthhMxO zR2l2Vj1UKIqfSX46PrTStUsdV0631GwlE9ndIJIZV6EH9RHQjscz4yBFh8yzYZY5mEhUgxfz1+a vljygphupDd6oVqmnQEF9+hkbpGPnv4A5XPKI+92PZ3Y+bVbx9MP5x/R3vFdd/5yE89X8jjTvQ0m 3NQixIs0lP8AKeUMCfdVGY5zSL1un9mdNAeu5n5D5D9bG3/NT8xGlEh1+75DoA4C/wDAgcfwyvjl 3l2A7H0lV4cU60X8+fzD06RfrF3HqUApWG6iWtO9HjEb1+ZOTGaQcTP7OaWY2BgfI/rt9TZnPm7s VdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVQ+pajY6bYT399MtvaWyGSaZzQ Ko/z2GAkAWWzFilkkIxFyL5b/M782NU833b2lsWtNAib9xag0aWnSSah3PcL0Hz3zByZDL3Po3ZP Y0NLHiPqynr3eQYBlbu3YqjrnRdStdNttRuYTDa3pYWjOQGlCU5Mi/aKCoHKlK9O+FphnhKZgDco 8/L9r0Xyn+Zd55R/K6WztpOWr397N+jVbcQQBIw81DXrJyCDpyqe1Msjk4Y0Obotb2THVawSP0Ri OLzNnb5c/KmBaPo+v+atcWzskkvtTu2LySOxJ8XkkdugHcnKwCS7rPnxabHxS9MI/ig9/wDKX/OP flbToI5deZtXv6VdOTR2ynwVVKu1PFjv/KMyo6cdXiNb7TZshrF6I/M/j8WzRfy58grF6Q8vafx8 TbRFv+CK8vxy3w49zqT2pqrvxJ/6YsT80fkB5L1SJ30pX0a9IqjREyQk/wCVE5O3+oVyuWAdHZ6T 2l1GM1P95Hz5/P8AXb07L3nXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq +c/z+/MCXUtXbyvYSEafpzj68VO0tyP2TT9mLpT+avgMw807NPe+zfZgxw8aQ9UuXkP2/c8gyh6h tVZmCqCWJoANyScVew+Wvyz0PyroB83/AJgKCFAax0M9XkIrGkqn7TtT7HQDdu4F8cYAuTyur7Wy anL4Gl+M/vry8/kxOCDzJ+aPnau0SuBzYA+hZWkfQDwCjoP2m+eVi5F2cpYeztP3/fKX4+QY35hv ba71WZrMFNPhPoWCHqLeL4Y69PiYDkx7sScg7DTYzGA4vqO5955/s8n01+THkeDy15UguZo6atqi LcXjkfEqMKxxe3FTv/lVzNwwoX3vnnbvaB1GcgH0Q2H6T+OjINW8wukjQWZFV2ebrv4L/XOS7Y9p DCRx4OY5y/V+tx9NogRxT+StY6Z69olxd3ErPIvP7ZAVTuPwzL0HZfi4Blz5MhlIX9RAA/sa82o4 ZcMAKHkldtrdxbXJ4yPNa8jRZDVuNdt+xzndL29lwZTUpTw3ylua9/f9jm5NJGceVS8mWI6uiupq rAFT7HfPSITEoiQ5Hd0hFGm8kh2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KoDz BqiaToWoao4qtjbS3FD3MaFgPppkZmgS36bD4uSMP5xA+b4nuJ5rieSeZi80zNJI56szGpJ+ZzXP rsYiIAHIKeKXrnkbQvLfkjTLfzn5xblqUy+roWiihmIp8MzIe5/ZLbL1+1Sl0AI7n4PMdoajNrJn T6f6B9c+nu/HP3JDqWp+dvzY80JDBCTHGT6FspP1e0hY7vI9Ov8AMxFW6AdBkSTMubixafszDZPv PWR8v1dHuUPk7S/I35ba3BpY5XaaddTXF6wpJNMkDkM1Oig/ZWu3zqcyfDEYn3PHS109Zq4Gf08c QB3Cw+X/AC9aRXuv6bZy/wB1c3UEMn+rJIqn8DmHT6LqZmGKUhzESfsfaOpzG306d02KpRadq7D7 q5LtXOcWmnMcxH79nybTx4sgBYTnkj0TN7FFfTbdGFVaFAR7FBnrnZ8BLSY4nkccf9yHncxrIT/S P3pKfKs3rUEy+hXrQ86fLp+OcofZGfibTHh/7L9X2uw/lEVy3ZDGixxqi/ZQBR8gKZ2+OAhERHIC nVSNm12TQ7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FWF/nNO0H5Z646gkmOJNv CSeND+DZVm+ku27Cjesx+8/cXyRmC+npz5Y8s+Y9dvuGh2DX81uVkkUBTGu/w+oXIShI6Md8IiTy cXV6vFhj+8lwg/jbq9Y0X8gvMms6gdU866mVaU8pYYn9a4f/ACTIf3aDw48tvDL44CebzGo9pMOK HBp4/PYfLmfse06D5d0XQNPSw0m0jtbZABRB8TEftOx+Jm9ycyYwEeTyWp1WTNLimbK3zFYnVfLe q6fCwLXlpc2qlSPtSRtHT5gnGW4NJ0uTw8sJn+GUT9tvjHTryTT9Stb1R+8tJo5lU7fFG4an4Zrn 1nLATgY/zhXzfaokttW0hZrZw9vewrLBJ2KuoZG/VmRrNOM+CUP50f7HyUXiyb84ndhskbxyNG44 upowPYjPI8uKWORjIVIO/jIEWGbacQdPtqf76T/iIz1nsw/4Li/qR+4PPZ/7yXvK+6uI7aB5pDRU Ffmew+nLtVqY4McskuUR+B8WOOBnIAOtJZJbaOWRPTd1BKdaVx0mWWTFGcxwykLpckRGRANquZDB 2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2Ksa/MrTJdT8h65ZxAtK1o8kaDqzRfv Qo9yUpleUXEuw7KyjHqccjy4vv2fHOYD6q+lf+cctIS18l3Golf32o3Tnl4xwAIo+h+f35l6cbEv n/tRn4tQIdIx+0/gPVsyHmnk35rfnTZ6HHPovl+RbnWWBjnulNY7Wux3H2pR4dF7+GY+XN0D03Y3 YMsxGTLtj7usv2Mg/JnQdc0byRDDrLP9buppLtYZDV4kmoQrf5RILn3bffJYIkR3cLt3U48uoJx/ SAB76/FfB4X+c/kyTy35xnlijI03VGa6s2A+EMxrLH/sGPTwIzGyQ4S9l2DrxnwAH64bH9B+LPPy G/M61FrF5R1eYRSxkjSZ3NFdWJJgYnowP2PHp2FbcOSti6X2j7JPEc+MbfxD9P6/m9i1LRra9+M/ u5gKCRe/zHfMDtPsTDq9z6Z/zh+nveXwaqWPbmFC1ttbtIhBG0EsS/YL8gQPDbMXSaXtDTQ8OJxz gOV8QLZkyYZniPECrLp1xPIsuoSrJwNUgQERg+Jru305kw7NyZZiepkJcO4hHaIPf3n4sDnjEVAV 59UwzdOK7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXyv+bf5ZXvlbWJr6 zgZ/L105e3mQErAzH+5kp9mhPwV6j3rmBkx8J8n0nsXtaOpxiMj+9jz8/MfpZV+Uv5xeWfLnlH9D 6yJo5rSSR7cwx+oJUkPOnUUYMSN9um+WYsoiKLre2uw82fP4mOqkBd9KSbz9+fOt66klhoaPpOmN VXk5f6TKp8WXaMeyn/ZZGeYy9zldm+zmPCeLJ65/7Efr+PyTj8mPyfa6eDzN5hhZLdGEmm2EgKmR hus0gNPg7qP2uvTrLFivc8nF7e7c4bw4jv8AxHu8h59/c9/zLeISPzn5P0rzZoculaitA3x29woB eGUD4XWv3EdxtkJwEhTmaDXT02QTh8R3h8p+c/IfmHyhqJttThPosf8ARr6MEwyjr8Ldm8VO4zBl Ax2L6VoO0cWqhcDv1HUMn8pfnz5x0OBLS84axZxiiC5LCdQOwmFSf9kGycc0g6/W+zmnzHij6JeX L5fqpmX/AEM7aenX/D0nqU+z9aXjXw5el0+jLPzPk6n/AEJSv+8H+l/awzzX+fPnPXIntbMpo9m4 IZbUkzMD2Mzbj/YBcrlmkXbaP2c0+E8UvXLz5fL9dvqLM585dirsVdirsVdirsVdirsVdirsVdir sVdirsVdirsVdirsVdirsVdiq2WKKaJopkWSJwVeNwGVgeoIOxGJCYyINjmwDW/yK/L3VblbhbST TmBq6WLiKN/mjK6r/sAMpOCJd3p/aLVYxViX9bf8fFEeX/yX/L/RLlLqKwN3cxmscl45mCmtQQm0 dR2PHGOCI82Gp7e1WYcJlwj+jt+1nOXOmdirsVQ9/p9hqFq9pf28d1ayikkMyh0PzVqjAQDzZ48s oS4okg+TzXXf+cd/JV/I0uny3GlSNU+nGwlhBP8AkSVb7nyiWnHR6HT+0+ogKmBP7D9n6mOn/nGB eW3mU8a9PqW9Pn9Ywfl/Nzv9F3+1f7L/AI6n2if845+TbORZNSuLnU2U19NmEMR+ax/H/wAPhjpx 1Lhaj2o1ExUBGH2n7f1PVsyHmnYq7FXYq7FXYq7FXYq7FXYq7FXYq8Z/5yD84eddF1jyXpPljVTp T69dT21xKI45KnnbRxk+ormi+ux264qyXybov5ieWW1LU/O3mxNb0qG1eQRJbLEYjH8byfAoZvgU imKoKX/nJL8oY1tG/TDOLupHC3mJiAcpWUcaputadab0oRiqNtfz6/K278yxeXrbWVlvJ5FghnSN zbPK5oqLOBwNSaA/Z98VRvmn84vy+8q6rcaVrmpG0v7e3W6aExStyR2CqEKqQzEn7I7VPQYqreVf zW8j+adH1DVtHvzNb6Uhk1GNo3SWJAhfkY2HIgqhoVqDQjriqA8ufnl+W/mPXrDQ9G1F7rUNRSR4 E9CVFHoq7url1Xi3GJjv2p44qhJf+ciPyli1c6Y2tVYSekbtYpWtQ9af3wXjT/K+z74qnfnT81PJ Xk6S0g1m8YXd8vO1tLeN55XStOfGMGi+BPXtiqlN+b/kCDyZb+cptSKaFdSGC3mMUvqPMCymNYuP PlWNu1Nq9MVU/I/5x+QfOt9Jp+hX7PfxIZTazRPC7RqQCy8hxaldwDXFWYXt7aWNpNeXcqwWtuhk mmc0VUUVJJwE1uzx45TkIxFksV8u/mz5I8w6wukaZeO97JyMCvFIiycFLtxZh2VSd6ZXHKCadlqu xdTgx+JOPp942Q2q/nT+XmmalJp9xqLPNCxSZ4YpJY0ZeoLKKH/Y1wHPEFsw9g6rJDiEdj3kBOtW 8+eVdK0qx1a8vlXTtSdY7S6RWdGLgsCSoPEUU1J6ZI5ABbiYezs+ScoRj64cwktt+dn5b3FxcwjV RGLZWcyyxyIkgXr6ZIqx8FpU9siM8XLn2Bq4gHg5+Y+1NfKP5h+VfNjTx6NdGSa2AaWCRGjcKTQM Aw3FfDJQyCXJxtb2Zm01HINiks356fltFBDN+kXkExICJDKXUA0LOvGqj8TkfHi5cfZ7VkkcPLzC fal5+8qadpOn6vdXyjTdTdY7O6VWZGLgkcqD4AADXlSnfJHJEC3Cxdm58k5Y4x9cOYQen/ml5Jvt FvtajvvT03TpBFcTyo6VYiq8FI5Ny7ACvtgGaJFtuXsfUQyRxmPrkLCl5c/NvyN5h1NdM0++b67J y9GKaN4vU4ivwMwpWnatfbGOaJNMtV2LqcEOOcfT5G6Xa3+bHkbRby+sdQvzFeWDIk1uI5GctIvJ QlB8W3U9B3xlmiEafsbU5YxlCNxl1sIKf88Py4hs7a6OpM4ua0hSKRpU4mh9RKfDv9/auDx4t0fZ /VmRjw8vMV8GR3fnDy3aeXk8xXF9GmjyIskVzueYf7IVQORY/wAtK5M5BVuBDQ5pZfCEfX3JV5d/ NXyTr808FhesLi3iadoZY3jZo0HJmQEfFQb0G+RjmiXJ1XY+owAGUdia2PVhfl7/AJyE0ibWNXj1 2SK20qKUjRpoIJzJLFzcBpRV9+AU/ZXKxn335O21PszkGOBx2ZkeqyKB25cvPvT78sfMFtcafr+q z+Zn1nT4ZzKZbiKSBbWMKzkfvO3Hw2FMOGXOzbhdraYxljgMXhyI6EHiPwYj+an5v+XtY8rPa+Wd VuIdRjuomJjE1uzxANyKv8NVrTY5DLlBGztOx+xMuLNxZoAx4T3Hd6P5i/Mfyt5Vt7KPWrp1urmF ZI4UR5HZaULmgoN/E5ccoiBbodL2Xm1JkcY2B9yYeVPOXl7zVZPeaLc+vHEwSdGVkeNiKgMrAdex G2ShMS5NGs0OXTS4cgq07ybhuxV88f8AOVsOmza9+XsOqP6emyXV2l9JXjxgaSzEp5DpRK74qyDy ppn5PaR5V85WvkDUUvLi70uaW/jE7TsEghlVG+LoKzHFXmemaNpP/QpWr6h9Th+vm+ST61wX1eS3 0MIPOldo2K/InxwKjPzO0jS9O/Kn8qLiwtIrW4kNlM80SBHaSe2jlkYsNyWk+I++Kpz531rylo3/ ADk7a33mkRjTk06JY5pk9SOKdlb05HG9APGmx39wqgPIk2n6p56/NnWvLqhfLD6TdRo0ScInmkWq uv2acjHKwFOhwqyD8l/LVq3/ADj5f32lWMZ8x3trqv1e7VAbg3HCaCHg9Cw2ooA/icVeaeT4tP1v 8qR5e1Pz7pehaas8klxpF1ZIbpZUl9QSLLzSSTkKbqOnw9sCs/8AzE0HRtNu/LOpaV56tdI88eWN BtooJb8enHeWqRyKki+oHAeQmT4PjO+/Ykqh7787ddk/KTy9rtxpGnDV77VpLVNQuoK2kMkQNbxY 9+MhDsCwPZ/liqF8kahcX/8Azklps915gsvMt1+jZVn1LTokhg5CCT938BKyFBT4/o7Yq9e/PKC9 m/LXUxa8jwaGSdV6mJZVLV9h9o/LKc/0u69npRGrjxede+ks8meaPy/u9B0HSNH+r/4iNk8dlEsI 9aC5S1b1mLlfgLcWq1fir3rkISjVD6qcnX6PVRy5MmS/C4t99iOLb3/oYL5B8xeTNM/K3zJpWsvH DrEjXKvaSp++lZogkIWor8L7f5J3265VCUeEg83cdpaXUZNbjnjs4/TuOQ33+z5pZ5ktL22/Iryy t0pT1dRllgVhQiKRZWU/JvtD54kegOTpZxl2ll4ekAD79mbef/L2hp+a/kmzSxgW0kT05LdUURsk TkopUChAyeSI4wPc6fs3U5Dos8uI8Xf71by5DFa/85F+YYbdFhiawUmNAFX4orV22Hi2+SiKybMd VIy7Jxk7nj/TNgfkDzD5Gsfy280afqyxjW7pZfqweOryq0KrAqPRqFJqt7VrlUTHhIPN3XaWm1M9 XinjvwxV78t9794RGs2Vwn5KeUIbxWCz6o7Ro1QfSkMxX6GBqPY4JfQGvBkB7RzGPTH9opmH58aN Y6b5e0H6pZJDoltfJ9eht0CrxCcU5cafsBlBP35ZnjQFOq9nc8smXJxSvIYbWgPPmr+WvMfnbyPB 5ReK6vYLhHkltV4iOBZI3RWoF+wqO3H9kV8cEyCRwt/Z2DNg0+c57ESOvU0fv296a+WNN0+8/Pjz Y13bx3Bgt0aH1VDhSyQqSAaipUkZKIByG3G1eWUOzcPCSLP/ABTGPy40jS5fy8/MGWW1ieWGK5WK RlBZRFA8iBSdxxcA5XiAMTfc7HtTPMarTgE0TH7SAluuJd/8qV8kXAJFlDfXX1lyvqKrG5l9NmTo QAG2Pyxn9A+Lkacx/lDOP4jGNf6UX+hmGhafZat+Yeh6zcedrDVtTgV47e1s7VY3kiWKRijcGIWi s32h02ycRchu6rUZZYtLkxjBOEDzMpXRsfjZQ/Li/wBE0z80/Oen6o8UNxf6gy6fDIteZa4lIVNi BtIuMCBM2z7Vx5MmiwzhZEYer/Sj9SR6VDcyfll+Y6WikuuoKxC9o0nVpPoEYavtlcPpPwczNIDW aYy/mfbW32pf5x17yLd/lP5d07ThEdetvS9dEjpLGQjC4LvRdpJKHrvthkY8Irm36HTamOuyTnfh m+ux/m/IM+86+ddQsPOWkaHYzafojy2CSS+Yb+JXZUIY+mjNQBfg6HqT27znM2ANvN0mg0EJ6eeS Qnk9f0RP2ob/AJx+lEuu+d5RcJdiS6gYXcSekkvKS5PqJH+wr9QvbJafq2e0orFgFcPpO3Oto7W9 mzJeTdiqW6z5Z8t64IRrek2eqC35egL23iuPT505cPVVuPLiK08MVUNN8l+TtLM50zQtOsTdRmG5 +rWkEPqRN1jfgi8lPgdsVXp5S8rJoj6Euj2S6I5q+mC3i+rMeQeph48CeYDVp13xVde+VvLN9Z2l je6TZ3Nlp/D6hbS28TxQemvFPSRlKpxUUHEdMVYJqX5VXWqfnJL5p1KCyvfLU2l/UZbO4/eO0g8Y mQoRXevLFWe6Z5a8u6Xpsml6bplrZ6bLy9azhhjSJ+Y4vzRQFbkuxr1xVX0vSdK0mySx0qzgsLKK pjtraNIYlLGrEIgVdyanFUovPy4/L+9v21C78t6ZPeu3OS4ktIWd3rXk5K/E3ucVSv8AMqP8rdN0 yHWvPGnWc1pAyWkFxPafWXTnUrGvBHcLsTTpirIbjy55Z1HRItKuNMtLjRQqGGweBDAqrunGIrxW nag2xVT0zyX5P0qeC40zRLCyuLVWjtp4LaKOSNZPthXVQw5V333xVOHRHRkdQyMCGUioIPUEYpBp KtN8peV9Lumu9N0m0s7pgQZoII43oeoBUCgPtkRADkHIy63NkjwznKQ8yVt75N8pX18b+80ayuLw mrXEtvG7sRsCxK/EfngMInonHrs8I8MZyEe6yi9S0TR9Ugjg1Kxt72CJg8UVxEkqqw2BUOCAabZI xB5teLUZMZuEjEnuNJV5p1TyZpF7pl9r0UIvZJvq+mXL25mlSRuyOqOydfbITlEblydHh1GWMo4i eGrkLoftTaPRtIj1OXVY7GBNTmURzXyxIJ3QAAK0gHIiijv2Hhk+EXbinPkMBAyPAOl7fJgH5a/l JaaR5eksfNWn2Go3gvJLi3kKCcLG8cScayIp+1GdumU48VDcO87V7allyiWCU4x4QD03s9x82f3+ i6PqEMUF/Y293BAweCKeJJFRlFAUDAhSBttlxiC6PHnyQJMZGJPOir3Vra3dvJbXUKXFvKOMsMqh 0YeDKwIIxIthCZibiaIY95Tj/L0Xt/H5Yt7GO8sn9HUDaRKkiEkjizBQSKoehptkIcPRz9adVwxO Yy4Zbxsp3DpGkwahNqMFlBFqFyAtxdpGizSKKUDuByboOpyfCLtw5Z5mIgZExHIXsPgpWvl7QbS1 ubS1021gtbzl9bgjhjWOXmOLeooFGqDQ1wCIHRlPU5ZESlKRMeRs7e5fHomjRaX+iY7C3TS+JX6g IkEHFiWYelThuxqduuHhFUg6jIZ8ZkePvvf5oXS/KHlXSbj6zpmkWlnc0I9aGFEcA7EBgKgHAIAc g2ZtbmyipzlIeZKrN5Z8uz6qmrzaZbSapGQUvWiQzAqKKedK1HbHgF3TGOryiHhiUuDuvZuPT9A0 W0vbiG1trC1YPcX7xxpGrBVJeSTiBX4a1JxoAIOXLllEEykeQ3v4BiM93+Tdh5afXfqWnfoO+lWC SaKyDrJIGqEZFjLfCyVoR2yq8dW7SMNfPN4XFPxIi/q5fayvUvLnlvWo7d9R022vkiWtuZ4UfirA bLyGwPhlpiC63Fqs2EnglKN86Kvp+iaNprzPp1hb2b3HD12t4kiL+mKJy4AV4g7eGERA5MMuoyZK E5GVcrNo3C0uxV2KtOyopdjxVQSxPQAYq8G0f81/zn87z6nrPkTR9Ofyzplw0EMN4zC4uigDcQxd ArlHVqfCFrSrYqnPmr8z/wAwNR/MKbyF5BsbH9JafardatfaiXMcZZUYogSmy+qgr8VSegpXFVLy p+cvmm80PzzY69YW1p5v8m2d1ckRBjaymCOQqeJctQOgrRviBqKYqxF/zz/O3/BNp56Gi6YnlqOR YLmRuZkuG9UxNIq+pVE5jgNiQ3iMCvojRdUh1bRrDVYBSDULeK6iFQ1EmQSLuNjs2FXiOv8A52ee NR8zeYrHyg+iWOm+WWaKV9YlZJ7yaMsrrAvJAfijIA+kt8QGKpF+a3n/APx3/wA472evPbra3R1S K3vIEJKLNEslShO/FgQwr0rTFX0hp/8AvBbf8Yk/4iMVeN335webtQbWNS0B9ItdH0d3WO3v5CLu 6WMEs0aclrUCoAp4VJzEOcnlT12PsPBDghl8Q5J9Yj0x9/4+SY+Y/wA5NUt/JflrzJpdpEzarcNF eWclWNYiVdEYEceTKeJIO1NslLMaBaNL2FCWoy4Zk+gWD70BN+Zn5t6b5kh0HUdGsptT1aES6Zax llWNnJALvzYME4NzFR86ZHxZg0ebdHsnQ5MJywnIQgfUe/7OvT7k+8gfmD5pvte1zy15mt7ePV9J hNwj24IRlXiCD8TV/vFII7HJ48krILh9pdmYYYoZsJPBM1v+PIsV0/8ANT83NV8rXHmGx06wGn6W W+u3DK9ZePxNwjL1pGjDlT7+2QGWZFuxy9j6HHmGKUp8U+Q7vjXVf+YnmaPzN5X8ia4kXo/XNRBe GteMkb+m4B2qOSGntkc0uIA+9HZekOnzZ8d3ww/ayTzl+ZGvR+cn8p+XH06zuLWAT32oatIY4gWV XWNKEb8XXxrXtQnLcmU3Q2cDQ9lYjp/Hy8cgTQjDn71Py5+cksvk7X9U1q2i/Sfl2RYZ47Vv3U7S sY4Shq9A0gIJ3FPiHhjHN6ST0TquwgNRjhjJ4Mu4vmK3P2fqSi5/Mv8ANbStFsfN2q6dp7eXb5oz 9Vi5rOsUtSjVLGnNeh37bDInLMCzycqPZOiyZJYISn4sb3PKx+p7HZXcN5ZwXcBJhuY0liJ68XUM v4HMkGxbyuSBhIxPMGnkPlPzfcW8P5lXtnp1hZ3Oju0sUkELIZnVrihn+M8qenXanU+OY0JUJEPU a3QiR00ZSnIT7zy+nlt5/cmmqfmV5htfygsfN0aW/wClblkWRSjGGjSshovKvRf5sJyngBcfD2Vi lr5YDfAPnyVE/MfX7fzz5b0vUI7ddG8w2MM8UqIwdbiWIngGLEf3oApTowxGU2L5Fiey8UtNknAn xMUyPgD+r7lKP82dQXWvOVzJDFJ5a8sx+nCUBEsl0XWJEMlSvF3V+i7Cn0nxjZ7gyPY0PDwgE+Ll PwEefLyFMfX85fOenwaZrurHSLjRdRlVZdOs5Ga9t42qeTLyah4iu9fA8ScgM8ueznHsLTzMsWPx BkiPqkPSfx+LZB5r/MLzxbfmCfKvlyxtb1p7VJLczBhwZviaWRwwBRVB22/gZTyy4qDg6PszTS0v j5ZSjUt6+4ea3yn+YOvavpfm7SfMlnbfpbQbeb1ERawyqEkVkdOTchyTehoQe2McpIIPQJ1vZmLF PDkwylwZCPeOTDPMt+t/+QGnXS2lvZc9Sp6FohjiHF5lqFJY1NN98rl9A97ttJj4O1JRsy9HM8+j 6Asf94rf/jEn/ERmZHk8Rk+o+9WwsHYq7FXYqtkjSSNo3FUcFWHiCKHpir528m6B+ef5Zxav5V8v eXbbWdPvLtrnTdYknjSNC6rH6kil0b7Ea1Q0oQachiqca75V/Mzyh+a99568r6PH5istctVh1CwW ZIGjlCxhvtU/bh5KwB6kGnXFVvlb8s/PUmjfmL5k8w2kcHmbzfp93b2OkQvGxjEkMgRGkqVHJiij 4+g+LfoqpT/lz50b/nGK38oLpjHzGkhZ9P8AUi5AfpJ5/t8/T/uiG+1+OKvXvImm3ml+R/L2mX0f pXtjplnbXUVQ3GWG3RHWqkg0ZSNsVeFXX5YeZ/KnnjzBeL5DsvPeha1cNdWLyyW8cts0kjOU/eKx WnqUb4eJoCCN8VTrz/5C82a3+SdtpOmeVLbR9Zk1FbubQdPeFY40BkUOX5KjMU4cqHFXuNnG8dnB G4o6RorDwIUA9MVeFaf5A1/ypqGo2Unkm082WE8xfTr1pIldENeKtzDkCgFRQb9zXMMYzE8re1yd pYtTGMhnlhkB6hv+PxyTrzz5J8zar5R8r2thoUNldWl2017pto8SxW4ck7EtxPiaE74cmORiNu9x Oz9fhx58spZDISjQkbsp95n8s65efm55Z1u2tTJpdjbyJdXIZAEYiWgIJDftjoMsnE8YLhaTV446 HLjJ9ciKHyQWk+VdftPza806/cWhj0i8094ra75IQ7kW+wUMX/3U3UdsAiRIltzazFLQ4sQPrjPc f6b9bzjyLL+ZU/5eX2i6BpMd9pWrSzQG7DqkkLOirMrBmQUZOhP9mUwMqIHJ3/aI0g1UcmWZjOAB rv7vtZnrv5Z+YbXyd5L0Wwt/rtxpV6LjUXjZFCGRzK5qxTkqsxUHwGTniPCA6nT9rYpajPkkeETj UfhsG/O/kPW7X8wrjzVZ+X7fzRpeoQqt1psrRq0ciIiFlD13PpAhgD1IphyQIldWF7P7Rxy0owSy HDOJ2kL35/r+5Hx+SNR1/wAi69pjeW7PyndXzRNZQwsjFzbsJEMzx/5VV+zsDWmEQJB2poPaEMGp xz8WWaMbu/Pba2PXug/m35g8raZ5HvNDi0+zszDFcas80bKYbccY/hVj0AFeNSfbImM5ARpzseo0 ODNLUxyGUpXUaPM83ttjawafp1vaI1ILSFIVZj+zGoUEn5DMoChTyOSZnMy6yN/N4n+W2kya2fzR sbZ1H6SlaC3mrVCztdcTUdviGYuMWJB67tXMMP5WR/gFn/YJbc+VfzgvPIC+T30OKOz0yT1BMZYz NP8AveSxx0fj8PqFq+A612MeCdVXJyIazQQ1XjiZ4p+Robczt5Mx/MXyN5i1Dyf5Yn0e3L+YvL/1 crErIGFI0D0ZiFJWSND1yyeM8I7w6nsvtDFDPlGQ/ust/f8AqJU/LX5W6o35TapoeoAW2va3I11O ZCG4yxyK0KuyFtj6QJp05HGOI8BHUstV2xD89DJDfHj2Hurf7/sSTQPLPmSzs7TR7v8ALTT7u8gK xy6vNJB6boGoZHG/JuI3+P6N6ZARNVw7uZqdXhlI5I6mcYn+EA/L8BmP+Gdc/wCV1/p/6of0P+j/ AEPrfJOPqcaceNeX4ZZwHxL6fsdV+bx/yf4V/vOO6SnRPJnma38zfmDdzWLJbaxBcJpsnOMiZpOZ UABqitf2qZAY5XL4uTqNfhlh08RLeBHFz2qknvfIHm+T8ktP8vppznWIb5ppLTnHyEZeU8q8uP7Q 74mB4AK6uXj7SwDtGWXi/dmNXv3B7ZaI0drCjijIiqw9wADmUOTyEzciVXCxdirsVdirsVdirsVd irsVUry8tbK0nvLuVYLW2jaa4mc0VI41LOzHwCiuKpJYed9HuLGbULxJ9GsIVjdbvVUFnFJHNXg6 PIwG/HdWow2qBUYqmLeYNAW4trZtStVuLwKbOEzxh5g4JX015VfkASOOKoO884aJYaxe6dqE6WK2 Fnb39xfXLxxW4jupZoUXm7Cjcrdq18RiqYXOr6Ta6cdTub2CDTQgkN9JKiQBGpRvVYhOJrsa4qon zJ5dFwlsdUsxcyw/WY4TPFzaDjy9VV5VKcd+XSmKpJ5Y/M3yzr+nNqMcy2VmsUdwZrqa2VVSZnEY fhK/puVj5FXoQD41xVOX8xeWpfqtu2qWZbVFP1CMXEXK4VtqwjlWT/Y1xKQaNpX5Sh8iaBp91peg 31qttZs1xexC6WYwlqBmlLOxQfB+1kYQEeTk6vWZNRPjyG5VSN/xl5Z9OS5bUbZdMit4ro6q08It DHO8kaUm50+1C3t4HrSTiom48x6DAYVfULYzXMTT2cAmj9SeNVLloVLDmOIrUbYqhf8AF+kHWNP0 kSKL2/tnvPSaWFXiiRVI5oX5Etz24A9CemKo/TtZ0jUvV/R19b3voMEn+rypLwYioV+BbiSN98VS G/8ANPkzWZNV8vXN5BNZR2Rk1S6WeMQRxu7QvHJKr1jdSu9aUwEWKbMOWWOYnH6omwifJug+T9C0 9bXy36It7ut0Hjm9Zpl2X1A5ZiyjYbbZGEBHk36zXZdRLiyGyyHJuI7FXYq7FXYq7FXYq7FXYq7F XYq7FXYq7FXYq7FXYqgNf0eDWtC1LRrh2jg1O1ms5pEpyVJ42jYrWoqA22KsWufKvna8j0iW8vtM mutCuI57SMW8whnItp7aRpgZGKkidXTj9kr1NdlUBpv5SyWagtdwSyqND9OQQleDaTqL384jBLFE lEnBFB+EAVriqZ+aPJGs6lrl3qum6glo9xa2FrwIYMVs7m4mkHqp8cfqLcgBk+IU98VWQeQtRtfJ egaLDdW8t/oM8Nwkk8btbzNEXBVl5cx8MhKmpowB3xVD2v5daquspc3NzYmzkv7bVrkQ2zpMs1vZ JaG3hYuwWAtHyFakKSm9a4qgNL/J+ezXR0ku7eVNOtNFtp09I0lfSbieZ3of9+euAK9KYqtuPyo8 wuthbRaxEmn2l6L024SRKFNXl1JQvBlD/u3SIB6hOPJRviq+f8obp7KCCK9gieG2uo5KRtwllm1W 31KMygFeSUtzG46kMcVTC/8AI/me6kur2K/tLO9u4bGGSO1jlhi42d1ezsquGMqF1vVq6mpZWOwb ZVCaB+WGtaNbfVUvrO7jn0230+6luIJGkQ2onCNbnn8Kt9Y6NXiQTvXFVSL8sdRS9ob23axe8ttS kkMT/WxPbWKWYiSTlxER9Ll0rRmXvXFUz8leQpPLckB+sRsiaFpmjzLCpj5z6eZ+dx/s/rG3fFWL w/k1rP1CK2l1G0Q2Nnp1lZvbRSwNINMufrCyXDrIG5y9yh+FviFcVZr5R8rzaDbW1sI7UQxR3HqN GJpJvVuLkznjNM7t6Z5Esp/a3FBtirJMVdirsVdirsVdirsVdirsVdiqRee/MFz5d8oaprdrGk1x YQmWOOWvBiCBRuJB7+OXabEMmQRPVhklwxJ7nz//ANDU+cv+rTp33T/9VM3n8j4+8uu/lCXc7/oa nzl/1adO+6f/AKqY/wAj4+8r/KEu53/Q1PnL/q06d90//VTH+R8feV/lCXc7/oanzl/1adO+6f8A 6qY/yPj7yv8AKEu53/Q1PnL/AKtOnfdP/wBVMf5Hx95X+UJdzv8Aoanzl/1adO+6f/qpj/I+PvK/ yhLud/0NT5y/6tOnfdP/ANVMf5Hx95X+UJdzv+hqfOX/AFadO+6f/qpj/I+PvK/yhLud/wBDU+cv +rTp33T/APVTH+R8feV/lCXc7/oanzl/1adO+6f/AKqY/wAj4+8r/KEu53/Q1PnL/q06d90//VTH +R8feV/lCXc7/oanzl/1adO+6f8A6qY/yPj7yv8AKEu53/Q1PnL/AKtOnfdP/wBVMf5Hx95X+UJd z6A8ieYLnzF5Q0vW7qNIbi/hEskcVeCkkii8iT28c0epxDHkMR0djjlxRB709ylm7FXYq7FXYq7F XYq7FXYq7FXYq7FXYq7FXYq7FXYqw384/wDyWPmL/mEP/ElzL0P99H3tOo/uz7nxVnWuhdirsVdi rsVXSxSRSPFKhjljJV0YEMrA0IIPQjBGQkLG4KSCDRZSfy081Dy1+nvqp+r89xySnoenz9fly48O 1c0Y9o9J+a/Lcf7yvPndcP8AW605n8n5PD46/s72LRRSSyJFEhklkIVEUEszE0AAHUnN5KQiLOwD hgEmgtwodirsVdirsVfZf5Z6jHpn5N6VqUqs8Vlpr3EiLTkyxB3IFdqkLnJa7++l73faf+7HuVv+ Vp6Z/wAqu/5WF9Sn+oeh9Y+pVT1qer6PGteP2vwzEbks1v8APjynomv+X9G1G3uom8w2lrfQ3dI/ RhjvHZEExLhhxZPiIBAGKprq35o6XpuqeaNPks53k8raemp3TqU4ypIhfhHU/aoO+Kpbrv50aPY+ W9CvbWzu7rWvNNsJ9E0e3hFxPV0DcpEV4xxTkK0bft3IVSv8qfzCjWLUtA8wyaufN1jDJqd/FrEa xPLF9om1jV2RI1BFEB9996Kph5X/AD48qeZPKev+YbG2uY/8OxNPeWE3prO0YQurJxdlo3Fl3PUY qzC0802dz5Mh81iKRbObTl1QQfCZRE0An4dePLiadaVxVjPkj82z5uubEWflbWLXTL8SNFrFxFEL QCNWNWdZG+0ycBt1xVX0D82dJ1n8t73z3DZXEVjZR3Mj2jlDMwtakgEHj8VPHFUv1H879MtYvLIt tD1LUr3zTZG/sLGzSKSVUVPUZWBdakLU7eGKq+nfnj5MuvJup+ablbrTrfR5zaahYXUQW7S4qAsQ jDMCzE0G+2/KlDiqD0789bBtX0yw13y7q3l2HWnWLS77UIlWGR3pxViGqhPIfLvtiq3Xvz80fSNY 1zT/APD+r30Plx401e/tIopIYVkFVdqyKQDQ9adMVROsfnfo9pq+l6ZpWjalr8+r6bHq9n+jo43r bSs6iqu6MCPT322xVM/Mv5n2PlzyFH5t1XTLu1MrpFHo8wSO7MskhQRleRXlxBfr9kYqnHknzfpv m/yxY+YdODJbXqk+k9OcboxR0biSKqynFU8xVhv5x/8AksfMX/MIf+JLmXof76PvadR/dn3PirOt dC7FXYq2qszBVBZmNABuSTiTSgJ75I1DRrDzFa3GtQRz6ahLzrIruRwUuvAIV+MsoAr8O++2avtn Bny6aUcEjHKeRFde+wdu/r3buTo8kI5AZj0or8xNb0PWfML6ho1ulvaXKidwFZZjNJvL61WZeXOv 2Php9OY/s9otRpdKMWeXHOO3SuEfTw7A1w1z3u2euywyT4oCgfnfW0MfO+uny0PLXKP9DBAotuAq H9b1/V5/b58velNqZeOxdONV+ao+N/Ovpw8PDXKq+3dj+bn4fh/wftu0V+XWuaFovmBNQ1q3S4tb ZTPEODNMJ494vRoyqG50Px/DQeOY/tFodRqtMcWCXDOfpPLh4T9XFsTVX9O9+VstDmhjnxTFgfO/ JBedL7Rr7zFczaLBHBpjENbpEjoTzAY8w5Y8wzcTT4dttsyux8OfFpoxzyMso+omvsoDbqOtc92G rnCWQmA9KSEFSVYUI2IPUHNm4zWKuxV2KvsPyFYz3/5G2VjAKz3ekTwRDxeRHVevuc5LXf30ve77 T/QPc8bT8xNDP5AN+XjJcDzuP9xo0P6vN6xk+ueoCPg4/Y7VrXamYbcn/mf8vofMf5j6f5R1IKly PIUMMcnX0ruC6YRuCOyyLvTqKjvhVivlDVNf1DTvzRHmCNo9Z07y2um33M1dpLNHh5Of5iE3Ndzv gVOrLUYvKWuflb521mKQeWB5ai02e+SN5Vtpykh5kJyILCZR0qRWlaYVTpdXs/Pn5u33mvy2JJ/L uieXbixudUMckUU1w6zERL6gUmgmr0/Z8OOKvOdV0DUfL35VaB550aOttrOk3OheZIRsGWd5Vgma g7EKK+KoO+BX0No4P/Kg7EU3/wAKxCnev6OGFXmf/OOnmTyhEmhaX/jLUZ9cmgmiXytIsv1GN6vI eDeiEqEUsP3nU/RiqQ+XPPGg+WvyW8xfl5rJntvOAa9sYdK9CVnlkuvhjKELx41Pcj26ioVNtS8s a83mv8otAS+m0DWk0K4iN5EqvLbyx2bMy8W+E/Z4MPnirGm029f8r9b0z6jLd+aPK3mmPUfNqEvL JeRfvUE5BNSrE702oOffFWZ/mV5+8ufmmPKnlryVJNqGpNq1vqF2ywzRfU4IldJGlZ1UDj6tSVJG 3uMKqGn+TPMHm/8AMn80tHsNe/QmlXFzZRayiWyzy3ETpLxRHZk9LZWBI61wKgfzHtPLHlP82/Lm nXOv33ljR9O8sQ2sOp2XN7n4Li4VUPCOUnnT4vhxVM/M+t3nm/zP5F0PyXJ/iiDQrUa/Nc6i7wC5 eJxBDJOzIrB1dST8G/LCqcf84+XWp6D5h82fl9rFvHZXdlONWsrOJ/UjSC6C80iagqicoqHxY4q9 vxVhv5x/+Sx8xf8AMIf+JLmXof76PvadR/dn3PirOtdC7FXYqyj8ur7y5Y+ZIbrX4Uextv8ASFlL SB0lh+OP00Q0kLOAOLCn45pPaHBqcullDTGskvT0qpbGyeVCzY397maGeOOS58hv8vvQ/nufy/N5 kuX0CGOPTG4yQvG0jc/UUOxYSH4CGYrxAFKfTl3YkNRHTRGpJOXry6bbVzHW+v2MdYcZyHgHpY/m 1cV2KuxVkPkO58v2/mO3l1+FJNNjrJI7tIpQxAupQRn4yzKF4kEGv05qe28eonppDTmsp2HLrtvf IDnY3268nK0UsYyAzHpVfzCvfL175knutAhRLC4pP6gaQu8k3xyc1c0Qq5K8VFMr7Aw6nFpYw1Jv JH09KqOwojnYo2d/cy108cslw5Hf5sZzdOG7FXYq+0fymuIrb8qNCuZjxhgsTJI1K0VCzE0HsM5L Xf30ve77T/3Y9ya+W/NuieYZjNp9nfRkxLMl3d6fdWkckbU4+nNPHGr1BqAp6ZiNzIPTTn6nEc6c edN6daVxVowxHnVF/ebSbD4hSnxeO2KpdZa3pt9qup6JEjevpIgW7VlAjIuYy8YXff4RvtiqYpHG iBEUKg2CgAD7hirHPL/nfy5r9y1jpcN1LbcZPRvGsriOxmWJuD+lcNGIXAb337VxVkvEAcabdKdq Yqgbp9M070Znt+JlmjgjaGBpGDzMEWvpqxVat8TH4QOpxVWvXtLaCW/njDfVY2kZwoLhUBY8ScVS e585+Xrfyja+cLn1F0q4gtriBxC0k4W+MawqI4w78maVQQtcVRfl/XLDWI57i1s7y0KsFl+vWVxY u5pUELcJEzgeIxVMo4YYyxjRULmrFQBU+9MVbWONWZlUBn3dgACaeOKrZba2mIMsSSEdC6hqffir aQQxmscaoacaqANh22xVsRRiQyBAJCKF6CpHhXFV2KsN/OP/AMlj5i/5hD/xJcy9D/fR97TqP7s+ 58VZ1roXYq7FWZ6T+WGr6l5UufMEM9sIYmjMZNxEqenRjN6jEj02T4Nmp1zm9V7TYMOsjpZCfFIH +CXPbhrb1A+rcWBTsMfZ8p4jMEfP533MNIoSK1p3HTOkde1irsVdirajkwFQKmlT0GJUMy1n8sNW 0vyraa/NcWzRTGQy8Z4mThRTD6TAn1Gk+I0Wuc3o/abBqNZPTRE+KNfwy8+K9vSBtuau9nYZez5Q xCZI+fyrvYZnSOvdirsVfY35eKzfknp6qCzNpUoVRuSSr7DOS1399L3u+0/92PckF/onmuw/LPSG m1nU9R06UaUusWMcMMU9vp1U+tLAbSGG4NE+FqszcK98xG5JNQ05r9tQs/LD6hD5KvdX0GC3eBri ILJJcFdQezZqOsfpMnNh8PKtO+KorXdKuNCuNa0e3TUE8k22s6TPqMELXEpSwmtXN0I2BaYxG4SJ pQhJoWxVJbG3t45vMM+jW+rR+Sptb0lr4lLoTPpawTet6II+sG29fhULv6de2KvSvyvCrqnmdtKE 48nGe2OhCb1uHqej/pZthN8fol+PGnw8uXHFWI2OoanZPd6H+Wl5f3mmSaZqMiaZe2ksX6Ku0jLW qQzXEcLr6kr8VikLU6j4cVQapdiGJ/y1TUhqa6DfDXzMLkE3nop9WE31n4Te+vyI479a/DTFU1hP lg6Fop8oLfC9Os6EdZMwvfXI+tj1frBn2L7P6tPp2piqSaZql9qHnE3cFncae14mt2uo6eltqBK8 YZJIVu7ueRoJHYxh40jjUJWgPQFVk3mKzu/+hdNFtik8VxFY+X/VEUZaeL0rizMjCPi55RhSaFT0 6Yq1qOu2tmugarBrmra3pem6yH1m7u7dleGCezniTkkFta8oRKVJPBqE/LFUpt4r7zQ1gGbVLbTt Q83agZaG4tJjp8lg7oj14vHFL8I7ddqHFVKeORbm5jWPUP8AlZS+YlWyYC5IXTheDgVP9x9T/R9Q a/Dy6/FiqXRGC6u9eexbVZfPiea7iPQ5SbtrdbaLUjzWJh/o4tliMnrKfp/YxVM9AtdYn82lrzUv 0f5wh1a8leCS2vmluLblKIoRL6htfqjQFOB4cVI/m3Kq/wAlqxv/ACcbBNS/xoLiQ+eGuBc09H0J RcfWzL+6/v8A0/Qp2+xtir3LFWG/nH/5LHzF/wAwh/4kuZeh/vo+9p1H92fc+Ks610LsVdiqc2Hm fzJDp/6FsrlxZTiSFrFFBWU3FFbktPjfoFJ3HbNfn7N00snjziPEjR4uo4e49BzscjZtyIajII8A Ox6e9JiCCQRQjYg5sHHdirsVdirYBYhVFSdgB1JxVN9Q8z+Yriw/Q97dO1jAIo0snACRG3BROC0+ FgCQxG7ftVzX4OzdNDJ40IjxJXcup4tzZ6jlXd0pvnqMhjwSOw6e5J82DQ7FXYq+yfy11W00f8md L1a8LC007TJLu5KDk3pwB5H4jueK5yWu/vpe932n/ux7mYR65o8lwLRLyFr1l5izEievTgJP7qvL 7DBunQ5iNyGTzVozafBdtOiSXNp9egsnkiFw8Xp+oeKc6N8PcGnviq+TzT5fhid7i/ggeK3+uT27 yx+rHAE5l2jVmagXuMVQ2ked/LGr3CRabfw3KSxQywzJJHxczh2WILy9QS8YixQqDT6aKpguuaI1 1HaLqFs11MXEVuJozI5jZkfileR4sjA06EHFVDXfMuk6KkX1yZRPPJFHDah0Ez+rMkPJEZlLBTIC 1O2KouDU9NuLqazgu4Zbu2p9Yt0kVpI69OaA8lr74qllj5w0y8u72GOK4jg0+WaC6v5oxHarJbnj IPVY02OKo238waDcyRxW+pWs0kodokjnjZmEdeZUBjULQ18MVQeo+cdCtLaO4iuEvle8s7BltJI5 Skt/OkERejbLWQMe9OmKpgms6Q5uQl9bsbL/AHsAlQ+jTf8Ae7/B0/axVw1bTn019TguEubFI3l9 eBlkQrGCW4spIPTFVGy8waPd6fBfJdRxwXCQSKJXVGX60qtCrgn4WfmKDv2xVC6YPKuh2lw9rdwW 9rfSzatLI86lGN3J6kk4Z2p6bO+xHw77YqjX13REe3R9Qtle74G1VpowZfUJCemCfi5UNKdcVQVp 5tsLrX49ESGZbmSK9mEjBOHGwuIraTcMx+JpwV26daHbFU7xVhv5x/8AksfMX/MIf+JLmXof76Pv adR/dn3PirOtdC7FXYqyb8vde0fRPMCX+r20dzZwqZQjR+pL60Y5Q+iaji3Om7bU96ZpPaDQZtVp jjwyMJy2u6HCdpcXeOG+W99ebmaHNDHPikLH6elKPnrV9J1XzHcXekQR2+nScXhSOL0mq6h39QVN XDkg0NPDbLexNLmwaaMM8jLKOZJvlsK5bVy69+7HWZYzyEwFRSB0dHZHUq6khlIoQRsQQc2wIIsO KRTWKtoju6oilnYgKoFSSdgABiSALKgWyHyHrOkaT5jgvNXgjuNPjDPKjxeq/KNS8fpbrRy4AqTT xzU9uaTNn00oYZGOQ7A3XPY3z2r49zlaLLGGQGYuP45L/wAwdd0jWvMMt9pFvHbWUwEvBY/Tl9WQ BpvWNTyb1K7g8adO+V9gaHNptNHHmkZzjtd2KG0a5bcNc975stbmhkyXAUPxdsazdOG7FXYq+vvJ uj3OtfkHBo1s6R3Op6Lc2cDykhFeeOSNS5UMeILb0Gclrv76Xvd9p/7se5Gr+XdyNbbVaWgujrdp qQuAD631W20qKxaLnwry9VZCFrTi3WpIzEbko0v8sfMun6Y+nBdLufreiWmm3F7K0vrW89pp5s6W /wC6PKJ3PLkSpFW+E1xVuX8svNd15lsbu7u7NtLsw6qFZhII5dIewKeiIFDsJm583l3Tai8QCqsi /LHzUbH1y+nWmtWel6VbaY8Ekzwi+0i5nmSWQmGNvTmjlVX+EmhYb7Eqro/yt8yW+peX1hu7WXTN JawnndmMU0lxbu73kjIkDeq07SFgzSjjuOO5OKpl5r8g61qfmSbULOPTp7a9fS5JZr31Bc236MuT MRb8UkB9RWNKsvE+NdlXeR/y6vtA8xzX94IZ0jF8tnfJcSGV1vrpbllktTCiJ9n4m9Z6kVoKnFUI 35d+YW/xZaNa6abbXzfGG/N1cmfjdsGWOW3MHpBRT4irk4qjZPy3S31S+1KztbOEyauuo2/pJxkF smjix9IcUFG9cyMFB40atammKsa8oflp5ln0Dy9c3dvZaVLZ2ugL9UjEqSumn3cV7O12GjThPRWQ JQ/FyJb4tlVaz/JzWYLSWFpLaW4thCtncy3Mzx3aQX8V+Y7q29FFiWVoaOQ8h+IkdSCqynT/ACt5 isPLPmGKCOxGsa9dS3a2YllWyg9eKKB0WUQ+o3wxmTl6Q5OTsK4qk0n5b+aIZrK1s57GTTPrGhXW oTTNMs/LRmiEiQxrGyESLApUs/WopvyCqEP5Pa2ltcBL2CSSzvYP0Dbh5IUXS7R55YLWWQRy+m6v dn4kjYfu49sVRR/KWY6NPaRw2cVydNS0s2eSS4ME/wBelvJCszxI/CsiUIUbj7IAGKp9onk3U7Hz cmszSwtbLFq8fBGcvXUb+C6i2KgfCkJDb9eleuKsxxVhv5x/+Sx8xf8AMIf+JLmXof76PvadR/dn 3PirOtdC7FXYq7FU/wDI91oFv5jtn163in0wVaZpTMOHAFwyCFl5MSvEKwINfpzVdtYtRPTSGnkY 5elcO/TfiB26kij3dzk6OUBkHGPT8f0Iv8x9U8t6n5hkvdAtkhtLofWJJQZfVeaX4pfVR2ZEKvXZ BT55jezmk1WDSjHqZGU4+n+GhEbR4SACdq3lu2a/JjnkuA2O/Xn5po35XIPIQ8z/AKYsuBlLeryn 9Iw04BAPR9T1fW+Hjxp75gD2o/1x/J+Dk4q/oc+d/XXBw73d9Kbv5P8A3HicUft5fLnaWflvqvlr S/MC32v26S2tqv1mGUmX1UmiNYhEiMqOWemzineozO9pNJqtRpjj00jGcvSfp4TGW0uIkEihf07t OgyY4TuY2G/Xn5IHztcaDP5huW0G3ig0uoNuYmmbmHAfk/rMxVvioVAAHTMvsbHqIaaI1EjLL/Ff Dt0ocIG3cTZLXq5QOQ8A9Px/SkWbRxnYq7FXYq+tvLt7d2P/ADjm97ZytBd2ugXk1vOhoySRwysj qfFWFRnJa7++l73faf8Aux7lWwi1iw1LyWlzNfxtfapcevFd3zXhkjGj3Lr8QoOHqLy4HuK5iNy+ 5Ov3vnvzIlvc38MOnpCtncrdJHp9q72XPlPbswMg9Q8jRDirHJ9V8wi30zy60mqw6/HrVtbaxANR DGZJdMup1e2vAKrFK0Ak4MFIIpxGKvQdZubrSNF8vRcp/Vl1Cwtp/VuHkl/eyAOJJVI9SnQ12bFW Jx/mt5qhsINRvdPsmtZ9Ok1gpbtKXjs7K8ggvOXLYt6FwZUp048Ty64qt1D81L6C4bWorX17F7HU pNLjjlk9OaODUrOxt53QEoQ7TNJzpUR/M4qnFn5u8/3cllYfoy1sr+4vbiBp7xZo43toIEmWZIVd nVmL8OLP2rWmKpJp35g+e4NI0+F44NW1bVL7WY4JUt5OKR6ZdyxemY0kXkW+EJQ/CgJPIgkqsn8x +dtc0/QvLk9vpnDWfMEkULWkgaYW0jWr3UilYyhkZfSKABh44qkl1+ZfnKBJJZdJtbU6fpdnqeq2 tw0nrVnvLi2kiiK1UfDb80LdOhBr8KrJfMGo+ZIfPPluwsLmCLTL2O7a+gkiLu/oem2zhl4ni3w+ /WvTFUL5K8+3fmCXQ45oYY21PQk1i4WMktHI8iJwAJPwfE1K77Yqkfk/W9ZsfMdyNUuIrgazrOo2 kszPcBYY9OikkRY0llkiRdqfCo261xVLrf8AM7zi9lf+Ya2Zs4PKVnr66UY3oJ5vrXLjIH505QgN Wvw0pQ1JVZDrvn/Xk11tG0OGymnbVrTS4prhpDGEuNOlvpJG9M15L6WwHUffiq7RfP8Arl5q2mC4 t7P9GapqWoaPHDE0hu4ZtOWcmaQGqlHNo1VoCoZNzirP8VYb+cf/AJLHzF/zCH/iS5l6H++j72nU f3Z9z4qzrXQuxV2KuxV2KuxVHHXdYNn9S+uS/U/SEH1bkfS9MP6nHh9n7fxdOu+Y35PDx8fDHjvi ut7rhu/6u3u25NvjTqr25IHMlqdirsVdirsVdir7R/Ka1trv8p9DtbqFLi1uLExTwSqHjkjcsrI6 tUMrA0IOclrv76Xvd9p/7se5kGm+UfKmlmM6ZotjYGGUzxfVbaGHjKY2iMg9NVoxjdkr4GmYjcjW 0zTX+t87WFvr4433KNT668PTpLUfGOHw/F22xVKo/IPkaPTP0Uvl7Tf0Z6v1g2RtIGhM1CvqFCpX nxNOXWm2KplFoujxWdtZRWNvHZWbI9pbJEixQtGao0aAcUKnpTpiq2PQdDjRETT7ZUigktI1ESUW 3mKtLCNvsOUUsvQ03xVZ/hzy99Xjtv0Zam3htmsIoTDGUW0k487cLSnpN6a1TpsMVW6V5Y8uaRHH Hpel2tjHE7yxrbwpGA8ihXf4QPiZVAJ8ABiqHufI3ky5iuIrjQrCaO7uDeXKvbRMJLkihmaq7uQT 8XXc+OKou88vaDe6XHpN3p1tPpkIRYbF4kaFBEAIwkZHFeFPhoNu2KrYvLHlyK3NtFpdolu0Edo0 KwRhDbxMzxw8aU4I0jFV6Ak4qq6jomj6lLaS6hZQXcthMtxZSTxrI0My7rJGWB4sKdRiqjpflfy1 pNzNdaXpNnYXNxyM89tBHE78yGbmyKC1SoO+KtX/AJV8sajam01DSbO7tTObswTwRyIbhiS0pVlI 5mpq3U4q4+VPLBkt5DpNmXtLdrO2YwRkx20ilXhXbaNlJBXpiq3TfKHlXTI4o9O0eys0glFxCsEE cYSYI0fqLxUUfhIy8utCfHFVS38s+XLbV5tZt9LtIdXuRS41BIY1uHHflKByNe++KpliqXeYtBst f0S80a+Li0vY/SmMRCvxJB+EkN4eGWYshhISHMMZREhRea/9Cxflx/v7Uf8AkfH/ANUsz/5Wy+Tj fksbv+hYvy4/39qP/I+P/qlj/K2XyX8ljd/0LF+XH+/tR/5Hx/8AVLH+Vsvkv5LG7/oWL8uP9/aj /wAj4/8Aqlj/ACtl8l/JY3f9Cxflx/v7Uf8AkfH/ANUsf5Wy+S/ksbv+hYvy4/39qP8AyPj/AOqW P8rZfJfyWN3/AELF+XH+/tR/5Hx/9Usf5Wy+S/ksbv8AoWL8uP8Af2o/8j4/+qWP8rZfJfyWN3/Q sX5cf7+1H/kfH/1Sx/lbL5L+Sxu/6Fi/Lj/f2o/8j4/+qWP8rZfJfyWN3/QsX5cf7+1H/kfH/wBU sf5Wy+S/ksbv+hYvy4/39qP/ACPj/wCqWP8AK2XyX8ljd/0LF+XH+/tR/wCR8f8A1Sx/lbL5L+Sx vSvLug2WgaJZ6NYlzaWUfpQmUhn4gk/EQF8fDMDLkM5GR5lyYxERQTHK2TsVdirsVdirsVdirsVd irsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdi rsVdirsVdirsVdirsVdirsVdir//2Q== xmp.iid:27e078c6-165a-f04a-9e47-b711ddca8baf xmp.did:27e078c6-165a-f04a-9e47-b711ddca8baf uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:58302a6f-5c4d-41ca-a407-9b2c7397ed39 xmp.did:1da897e3-7985-5e47-81ed-e15ecb360ea0 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:1da897e3-7985-5e47-81ed-e15ecb360ea0 2016-08-18T11:23:09+02:00 Adobe Illustrator CC 2015 (Windows) / saved xmp.iid:27e078c6-165a-f04a-9e47-b711ddca8baf 2016-08-19T10:38:52+02:00 Adobe Illustrator CC 2015 (Windows) / Print Adobe PDF library 15.00 }ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 }ICC_PROFILE E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht}ICC_PROFILE ! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dh}ICC_PROFILEjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<}ICC_PROFILE|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~}ICC_PROFILE !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$׍5+K E="iaRx2sm7 ȵ_8-$~fT:1B?˱22w gZ2'o<Ϯ~%p?h/yI ir?x'گņoI~"ZL7:" #EpTRgxw+aE'1$9fcOz< .o Ş3n=bX{ErV{jzh¬y*EIvj?OW[`5ƛ JB mfxVk_@# c$o%Q}m7˛d g#סuW?= r<.T%eץGE~~ÿY_ܖvSO^?w&A 8~> >_pj' <_rϗ4gF׃ ` XŜ3GzN?MEh@((((((((((((((3@(s\~-xW,V7,.aU2[JtQ tW럶ω/ɬ''c\ޡ:7om% QNkGO"̪kOQBO=ڊ:Y'G=suO"Qug8J.} Ex|ԃ~,xM;/Q]wvcxc>Z:эL3$Ch_@ jM'mc*3ZQjQMڤZ~jEFjŠ3EQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQMi61…P7W̟n,W`dx|-$?}ϟ@OOt~-qᾇ0(O.\OZq Z^>|63kN7[cmo?f:v]2MG2Hy`9?ڋGƛfͲjW?gͿ_zƫy-bQo. B̷WR9K1$bFm^WXۇ|!ɲT~_yDt_>.dnvʊŜgFp&ikק*5+4]g O/ۻ F Z\AMI>m[xB@`2J1"km:拮i2mo-lЩ9 ~1z?Qm-mOOVw0<$ HsOiG 7s[rt=g]EQ^QEQEQEQEQEQEQEQEQEQEQE!84^{s8qo>2!h g|W$7߃N_R .̪C2G}9kcRm}&M9kgKhRWufx:/t5 {X[Fdǻ~& 4j=ayld<[6Q?ʾb񧍵Ejs7r]H>^M\+Jq~if]R\~4u!%|[IfP ?|78Ij>{DZ>q/Ew?A=e:Ҳop/ /vYI{2}G jJiqM723x^/0O[,=̎ͺysKEsAN)Zi%4@W=-]ET E5"Xⷼ'K^d|Um E9WukF7Sf蠚55u_ NkF6곦{d?s^gu?7bs8ho1Uod%6O?qLJoZaXƓ{ү!?}! #zg@#v10ݧ> #Z teuKh|5+ƚL7>7 ++)[IVAxr92鷒[{at`E}U? +COXpG|Mϻƽ*9#oMOo W_^5i'hȢ _?Z;_i:íBFǙ'Loƪ^%QC e-=>~t*x<WGF?*8g5ʥˏ(yxI+QHik(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((3EdXcffUUzO|-MƓ xQG$VKfR!'~Q׿S߶KXzh?Cg"vcfVmJyG x_5h%_ݎ7d7n$+i)$2#z~d~՟TÞ*ZՐϜ m51K_;+N˲ ~=S*/;7[G|+((((((((#5ngǺ_|-]h gw6A*!VRA+= N5"Q&=SOtf~6࡚?𥤗otDtl  L.A*)OҀWe.CׇdoRm݄-[m*;`Aŭ­>[VQ:a0VC)_]cxO_g/Oee~W8׭$KYb[;EXGr+;GZCI2S~}X$~ |?>/x^*ֵ/kns4c2~(¨ ůfuk{H3{|,rVݯv/]UaV'1$ԚZ(4@(((((((((((+c WQwT_iRZ 71/=S?);w^OC.Ǯxvn\7(úpk tjG;ʪ`zž[?GlQ^_"~^ i~4c_*4eҁ@z A u#8Gf𕰵Eqm4MnQEYQEQEQEQEQA8lQ3*'S^=_~??bhW_'Oѭ1._Y\bfsGs/ @4Z;}a7G$^v32C]ϱ#gV 9-?ռ?B?m.4/G/C"MJ~scg=7/QOM_ky|uKumimH㏙?<זQ_1Ve5qRCYY|Ey+yQEqhQEQEQEQEQEQEQEQEQEQEQEQEQEQE}MY|<zk?򒏇Su~Wd?D+#_?\Š(pl((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((q@8O/%Ƴg- ˫W }] 5P+/b;?eWfc0iUyNa~PCWǯ_;\i 9CczI$||~k^=e/]9qk쿼I_ fFqXkyM~1Z#y[n)zQ_/RKn[MB ݾ݅QYQEQEQEQEQEQEQEQEQEQEQEQEQE/G ZxRΨV{E6C3n)ß/='#=f4 uꮧS"s_U*wšS 5{rK.1‹׳HGsF\_u?$3fcDĺ}}-EAVŌVuiuи9UH 8"N=QE(((_<7'w've:joU]۠UU履35NrvI+Dmi$e8Գ;*ԓW_3 0>"]^x@$Ӵl /y59Q[ { xI|%qW[˾<_"|n/AvpPۿ_Ÿ.;=WE7uiݽRuϊ~/5ks[Ԝs{y)YO<(1EBT -^AEPPQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE7gRQnj,J>=OM5_Q_iרs (񰢊((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((~*V/j&ViZ\~eUY(p52ҕ)՚M7&ն%՛i\\M!Id`O $ uamZ-ђß\IKxo%u=mR~ -g_ѐC_۵1x]pq{/q^6dtNQKkIXQ t[a&޻>l~U(xTge |=UyZ5?kំCw]1 㵼rk5-O'42"'ɨ$6I,hê*^z?G^GA7 |U+Oξ&q?[ȍj}HC῁%t M;w~Zw_O:$= >9jq_>;|Ciq»iٝScƼK'}OQwoC,O<F}J8/6&/6*HZ|ԅ|/ 3AXIl`HjSת>-ʼ*>IuG7E(\(()(y\?7\5~ %?랧毨/~WGQ^QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEPN(xO}?lڦڞ"F>n5 8fY K8 >Ikqb'_S [J׿/==_D(O ( ( ( ( (4Q>|KZ hulK!#_v"H?d7Rm=׾*x:& Z;M:fc+o Wr}CKw]CSuɏ (+OzG<7n@S㻷sĚ@{kYm^}f>T(4} |/ష4sCn5|Kq+ >|mڍYۥED@ ТzXjT<0gώ*ʹQ[PQEQEQEQEQEUMoB.qaY7IkkXfS,#؊E _FTdӺ_?4N?Rdïl _ q}_,%4];Q#]W=f^K?-?~d$geNWٟy|?_<[;-z׆u%?uV=c\y?¯ `ܚ?-+\mlH@aq| W^ϫ|%d~2Z\#y LFKV<;F]jiF_̯(KiugmwL<9meʱ^pkȔ\]GIVJfi4}MY|<zk?򒏇Su~Wd?D/x#_?\Š(pl(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((dH? |;k_5Ѵ},}pG+ FŒ ΙV P2⡃rvI~o[Hx_:'xX5~J1ʲb3xZƷjYX}AT>[/|kxZƱk3yWSX @V |v;\xkq0[ů_/^鲻1Q^aQEQEQEQEPMOuÖkn]oyPf4̃,*vq 6 8B;%xj-m4#OյK6vvqqr瀩 K U 4MH>a^uǞ-7)_Wwxo,K^T21%q_ER|a&#$N?O+=eK_Ÿ<oJޏl>[kjǦ=]wbXI&`0ihz1QV[֭RJrնl(0(((((((((P_|E 'M4{louGO;W'u> &yJvS헏,_I5ˉҮQ|EU}/Xth<X!W*|;/֭WSm{ xϹo"΅5k;SkZnyYj;2­5:sܤu1Y0o  #8.6t%(4jRw]RwQE|xQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQA8 n ~Ÿ^5j[-j3 d3@,ujƜ\Gf_1؈a0rݒ_[-Yw1" =cZl4MI}p2ЂmRJ|Q/?ԼSZ\1|eeU*"PV~6g' KX/R׵DcP6H4PTtԓ\|n;:_ދ2־mڜϐ̇`CR)ϸ/ɰY*ryIKG~y>(D𶇫xXelGoMP;}me{Z ׍/<7Dku+Oo )gfHA<8<=B=>7+n07ܴsp5;y q#4 L=P"je<='V-w~&g $FOYޒVUGwe}Oʝz Mz6[:-dk!\NÜd5V+?wEP0(W g O6\Z_ۤ\tiy?a_z6q}nLԮ#40Eܖo Ov-M՗T?{;Ք+}^:cp8l'YMo'¿#??P>#x࿃t'ni8ey_Wcͣx~(dJ)~엇ЮpA)\ <33Yf'$I=kl.!/˻}_~X=ﵴr0ؑM _>6¶:> iegpZZ6Y|eg؏k/?(O ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( #C~V/ }'C-vڐƣ'O@$I.9TvInS1#| !~C弼(҂((EiR4y$"gcI':I;h⤽`83DqhL zOE#ZgEmSj1ܐ+$O's2ZmZ6~SZVПX{>20O?_qiK??>oH?uya8vN.ݻ?3.4?S\KnHKRv>%?i]s]fmZPGZ 8,kJILap԰cXE$$QE&EPEPEPN*KK);mmaEbBJprI$FO#ĜI#~ i?~#b]JODtG|Nޜ.xqga2 u1'.잧c 1eg57>>O3Me䎧y&p(aB?812Xl'%/wv (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((@ $ffUU$+G #oګ x>^kpe?3#=T/\/(̟> LZ&jh>쒩_#QT =q{;gP0(O߂(((((((((((((+W|{c6m-c~F;:FDEJRJ)]K}3_l?.tמ d2t1dGS_O"?g|[+^0 KodWwQ_ڧP@j.?rvv36GvuҟlO ~/ClW H䑏{Mujc_G*VGj+TujRwm q_\(_|y_kVHORx[ 0OỘ[G4 9Fe<Daq )4Pi..i\3K'k1{ ?3_Y:>_{z+(H((3_D&Bϥl6qxSK?ײtk7۟aٖ'M7t'I%Ԏ?ȏ+ٖJ V9+ֲ:= x_+)XkOُݫv{Q^iQEQEQEPNʟ+$s뒂T^;$a#NJtRJݞ~ka$r KoD} Set=Ě-g_U<^ȧjGn?ҫhEXgcc [#4UGB* |߫,N{31^[H(>`((((((4ff $_~~Ӹ_gi_Mxy=fJ=9W[g^K'>3g '|ڻ\Gq/ZC5Ks!GF~%{2S>Ç+$_mE͈4O~k|kj XG56+潸4Ws6XzTI 9IOx4?-Ε#[:_fxunد?Uw1EvT~o=J|EkJ @K?o]go]s1\Î" O,E}3ll#ZCS-n韵/o _P'{gBms*jS*inʧO֋Gþ!=bFne ߑpH!w6浼?o’ӵK\nU.Kj9N/2=[|UGY/ ~zoԟR>1^czt=ܿ= <+ qTXOܝ$ ٗ $Vu5HQ_QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEWR?ۣNjѴ7>.zo6||8QN  | ^Ot+I/o.FI?^w'lк/6M_=NV%$vc1G~p[1YϤ>{˳hP񇈵 cVԵmZK۹|3Hŝ%5R+Er`(QEQEQEQEQEQEQEQEQEQEQEQERHz|Y {-Ç0~~1$`z}aV%5vxy`2l+ʺ/'+| 6}txd`:me +ȏ8\k?dاoEnΪu V_jn?I1s"WOxSšo9gh}imm-!XaAUTҴ+09m: .(q}7Kt '+(#l_/H5#IgˏnNU&fٮ-bw%ދ͟CضOZ埓⯈qp"~Nh#Lwg{P (cVi{/BײhUT`WQ??766[q{{5\]]HM,Y呉ff'I$zQE|QEQEQEQAl |h/3jn] kt,9숁eS_2?/~ϦǾ5 wf#E ߰$ZEgĞ4 ,7X餆 9~?9>[?ʾ.qqxY~Q^QEQEQEQEQAW7㦓= K[DpWg~O;3ӏVKvDo:x*.R}ggww4`QMyojm7Ev"Ը^ _߆-k-mB[EŸɮv%ĹaxjI9X2~N1*7|g3[},n$+avh3,^>cjJIo)7&oShЧF (tJ(q\FXѦ$j97W#/<_Ia(T~k<'FUǦ[&7HԱ\>w4caKT䛔xMG'Z%q'F[^O̺Gk5|U4"Smfιk+X}?Rk+\я}gZrpɏ= z655wł0^~~j ٯwOG_NQ]><'%eRZl<{-G:7%Uѧ\)"4n:)R?_kVW<աԬ-տ_Gk,Ժ*M?YFa|B튤/wϏ(F!/$L9ُb{9& -)TOiEO;40'w~Exahc;}AV^1#~C^ZW7:eͷdM e>ؚ z熵84mn9WCЏc~C(s&8m'vO{,'sSBw[?U74W|kyvz0;u?½5|M9]E:r-ԗTULt1TQE{QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEPN('ϷfK (sxzL{SYNr|UvFuƜ;ܾ?OWIynEőcS׉OpZV.l1uFZn/on&..&bO#gv'3IME_ JGR]O.]O/I'ӲQEb{EPEPEPEPEPEPEPEPEPEPEPEg+Cվ!xCtcY&ZYZDdCUG' _'*^ fE;cޖW葮rXy3<# xQnsjԵ"Ǘ)8L[xYhkX.i'˴ג3zG>6oc.HYx} ->ꟻ_y*Q__ӣH/>6}xIEvޡEWAgw<;}׶n7Ww#4ُ NF 31P9$hOd|Ou|ϷRT7(~xq=,v28xs=#8;Y9a1[.?T(DYi]Y846AW);>jh R+*TI9vhe9^-C, վ((*m?Ok;;y/%K{x"BO#TEQfbM{jΓ?џ_xVﵭrq J uy\ hW'!~:wF?tv*ge]N݈EE(L8+xfBNiV qFykp>֧g\u _-Qܿo:/$v N֛>9=4-N5I|YxX^('RZ<_ϭttHma5(@(ª +?m݅Q@(((H5,TT޹k2k㷶]p_ھlMZ4mC|E=~k?o a9򼗹M=_يwp|Υo.KΟ-%nGRK6?c^>;333119,}I.\ۉqTf+HAvzy[N[6W%(3 ( ? G/5yt *'ӹp +;W =Ѡ{+r{_t=uҔRo܋m95Fs88Isy.^oEª;NBIYQL()7s@Řᦸ! $tx$e;k kͯu>GOA+/!a1GO jOYͶn_mnQ:4wKֿ (ϵ (9)Ne8*}A|s4yuHN>֣2Y\42<3BᐎApdGNVU!}'KxˣOβZ9eWI/OUT\O+#*ܠ?I?598fX sSѮ4~֖ϠQE뜡EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEp(7Hqgw;UI~T?l?lڗRZOT;%OniA>Z:?- 4M~# ,ai`SM%23daA?-cE'I4N"u:?xc8,*][EQE}QEQE6G3$"~g?:nm*^.CgC+r/mYM?鲉<=\Ƴ:7|a (?W}C򜿙v_ASkI/ _q~~g/^ WoJGW}=ھrQϘz3R4iM$oC .;G_-Ժuju}3]Lzibܱ'jTu&ޙ>[ KOjqQ޿0+3 ( ( (c@A/ek?#z տuɄ?V߃rcjN!^ѿ?%׽יڅԓI$Ls9=I5W|)IN?aI%dQEHQ@Q@ q7ÿQ1+lXQ{_ZCCqo" $ף)-5?#2m.fC<%"~>\i<>> %UNtqW_⊿{~}ǙJൎ{?zW@QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQETww[I4,qBۢ$*Bp+?-Rd Mo/< 7r1+A8ʕ7R][#kfX I%~˫JPڶo#3C;(via}=)k')9Kvu04pxha0ЂQK+ÅQRuQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q3^u"6qSFh?"l( A  m?^ 9jMmR{b:?~f_ٯo/~m/4Ӱd;9Q[¿/?.#ifi*~inkhzjf#7Vw%kErc&j:d);ovVQEQR0ȥc|h–o#T\ÃF\isdq~PC6Wwc0Ln |3?|ǀeC9-+mD[k;XjD,NYI$^YWSI|$k]5ekh=[X,lX 1pFEQPJE[CRRm݅|=b; ]׎5xlX3?4Oξ+$t4 ( ( ( >|4>4|T׃?Q[pciT.% />etǒeE0}Vz.H]Yq&n=˸WM#/t>Ѽ7iz 6q$ "}Zؤ!R'9}QE ( ( _cqVSq^~ma\~2\O~m7ab*ƍ%yIwMYhoNa@>x.忺yifyf'$udb8OHG Y6r|_}_yQ_zEPEPEP_FxP?zUXԵzykVmЁ^_Dž8U[Ҍ53.$ϚWk (@<@((?k5(R5ă&O^+ӿk)%Z1d?WfiSx=w?v<kwšs˴#4HK;y$s_;b>+*ukgC'V_6QE|QEQEQEQEQEQEQEQEQEQEQE~߳jߋo#f.5-A$g73Jƹb(U WLյja*O;W,xU=J׹ޗ^]?exW&7gO 6Iۍ^nW;WT^2NXWӧEB xe|]ybq2r{}EUEׁ~?P?  P6&MC@^0܅S2MgV)nv]#ArvIZ%oDe+𩵍` AZ=DPj% W/~(>(j~0.jܜGn K#QQMOA~^*>*>2&jj )+#\ԒNI$ut_|7<,D׽.ݏH+((p('/Yۋ,Cgu:U~FxPQc~ڟm|+[RYuMRT?e-$B?{dKNԥ?jW敻T8e|斑_?2 Ya&KEj_j}/xKgl#t8̷roV9$WB +;،EZeZ&oVݰ*F<SOZܭ M@TLVqV5x'ZƵ7#lfm џn+5 2xhV[`b=ⷕ$G m,cp+RC/u?Xޅg0%8TI'sܱg$]_n=SKY &q ([ ( ( (Ҿa>!uciY6`H{o?|>96^][5J18i|VVݯEӓ^Qg|͏xQE~~QEQEQEQE}I="E'rs]vHWe_gk/K|R"\oKJkd 5 Uv0~3̸c'>y~gC.Q+_7YQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEu~>L>Yi$M/@c Z|ܱ1\qo)?n?k7ci~tUmG}2GxM|.2) CrudX|+V/4/y׷ (O ( ( ( ( ( ( ( ( ( ( ?1|=6WwI<Aܓ$j|9x6:FcuڤmgimkXQTu$ >Ğ"T[h0ɵ~NF9爟,vxj{e~Hw}h5M+zu ImM_PC;X H `,q.>)RP PPmb,\sNOW%-QElyMcJWS+Γ'yg|Ht1!Ķ~$}ȋ|># 0="ب0Dݑ_Q_)ao~NR!g ``s?h?:_MkN5^G~&iM_G5 {汭j۩<ɮ$ 8f:x]]O \~?=D(ϸ ( (^/-A_ [ku=Nd&I'INTd_> [6l>vQ՘x?d ?l![}ʿ5 QE֭rG4~J@z9~%w.?P{K5WK%~ɞYGvb ojM+Q 4QG&/[ZXD'vޭQEQQExO_`Zɿ6!_=6}xg ثm>"t8sܜ}Ek xydS/*W{Σb;Q^9 QEQEQE߰Ï[?MnAk,8Lctÿ!?0̏Z-pi~}FE R]3z8e:wɻ EW~*QEQEQP&c5čF=55*FsZ-#ڛZ:doI C+G^cVbO뗗dlZ,8ӈ'gomyEiKDexS/wŠ(;Š((((g$Z?so 7E6ڻ*SxIR"$-_hl`H؎kjϏbi ybŊN}w9y\qbpi-Ewj^k#x?<^ϣOUHFHث 20) E~QEHQ@PN*FJY܅U'}[s ke"u'c#¼t+"[VX@{JG^El|7їfPV6rkꢯ8=y, xOQEOQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@ymv7a4:-Y?zmbQQEz-|#|_o~z`mǎ-L൭n\nrj:>2 {NjNS?^yyvizI?RIhS((((((((((*΋xYt[GP-mBJ*$*QZGg$:Oe?Jf7 CO ˩s=X\,>W `+Y?.i> =,.񍭥^d$~6cduNMx(4x|<(BybldsN_r]]nQFy$*+l,y#THR5I9ɮc_/ UbDt3s#(ݻ*O_Qo+l k~nPYy L:)"g,q naOcx?s j+~4ͤ}- ԼGPo,Լ[WUcw#/˴<3I$]س;ĞI'$"K_#T>zo|3U'Io[.((3@k_M7 ӿuM76mc4O@bQ~#>>Sy6,z**ǀ&yO n/BϮ- 3b +<;8b'oS0?m*^u}z.t?Us>W횅T "d}+Ӎ8Ahv:3,V&NSolAEV(QEQExhY'yB7nQEzGEPEP\O `&o'㛏]x}{yGkg?gSZ 5s2ѦݯxMQ_IQEQEQEQEQE7$GmvUHWe_o5׊_DO+4(((l~#eǛώЇ?ZŞռ z`,lXp : R١+_$Ok< 8I}_-\&:kԏUs['}W +Hƚ6_W7sY']E\_ٗ׌pqNx/|>]Ey\+-c%㧤p*̓пf? X.^Sd*~b8֧N*+qWxI?_-g=~k>׷|(ЦPyth#RҴkM ` U*~G%ni?֎5jq}urk^T>/8lN*.{8?y|QEBQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE|S>#<#8-tCu$y&R$ zů~%L9n{o^.yRT;G =%J h(T ( ( ( ( ( ( ( ( ( Fph'97>}[ \* WzpV ;ސڃ9rQ*T<:8)nъ.lO"2MKunJ5=>jlv *T*P:)L,(S?1Y:XSHǤc/waE:uI$`ĞOJ>w}!lx C\G/2֒8=%şa /D?> +,:7)uigحF'+W_j^4_ꚶ15ć3ICqCWߧ˿~rsCiKWLg~տ/l]YK Q 698/4Q_7)9>ijL&ph(*%dQE'@QEQEPN+;gM?~Ѯ{T}>T_G?,q坈~Ҽ%dinS5O#_W v?UU:r횛~b>`$x}θLCMѧjzG^[%8~<%ԍoxXc5፵yHCOC!U-T/Ӕ(Fd$f+1DAEVQEQEQE~D7'Ft Cw%0G8?:"@ɝkOY`M'0yyxk6QEqlQEQE(ٿ7LGOW1 v-l1?I-`duڗ'x)?ґWo=?%xhQEwQEQEq}xM b= c |RLd<"㺿Fb]>۩M~._i< O4MuEW~QEQEQEQEQE}M?"m]q-WMe99~l( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (2i_CV/g5Dq#;~kM\jw_jS=zYŘ PuzKS-F>0_=zeypXcR(݂(((((((()=3'Pf|3[Et~rjG)l*2H|'~|3|#=m-!՘13K{HOpuZ,>:񲦡=D{Vˏ9 ܧI|Rh"O8>(r-V('p+ Q٥o16#RoKdSM:1υ2vmX\79uvKj}=H~<'u[6grAZg˂/#tIe:/4=6K;-="OEA{=|3/>.>!ֽ I#9D0ITIFSԯH~QpW\G{{OT-W~QEQFhp+>~iWkfyJ?N1rvFU=7W5ܚKvGmH~0k 8vD|u?#HA= 3Ljſۉ, x^9a-.suKk*hUQP:+e.~ueۯϱgx 2))KE^P].\~K KEt56[Z_R'IbhEY5NJ7vۻo}XQEFaEPEPEPEPU'w۪C?K!)K#/Cy?*W?3?9k0+`((J~7 \1ۧAFH_%\/| ߞ~k2y_ sq>!#_8FaEW~rQEQE5*埵ok|q8*?k^61ZFJ#TZMKQ_QEQEQEQEQE7$GmvUHWe_o5׊_DO+4(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((uLojh]/Ÿk n.RqqWN/xo.#<#ϱO9)ҝIr]nk`?XTݽݿ$>Ln5}B{˩P[YUP2^(~"5ǃ8Ku[!Hy8c6~~֩qu4{.g''9o<+ ~~aC ok绻uw=ى'ֺ1EF**Z֭RJrն (((((((({x U,MIs܁W `7,' 5MZCQG589Q䳨~՞ ⽦E:=aR_sQŢ+?` ( ( "(o"GG+,/4vhk_ҿOCW){yqұ<,f@Fju5e;A}6CR1(bӅqoEW~"QEQE/ßxV񖸷m̿Eq8X-\uxT$5ZTF7MzO 6]GƏ ImUv3}8(<}p\W[, ߥ)AŵG?0ףI5AEWnQEQEQEQE}M?"m]q-WMe99~l( ( ( ( ( ( ( ( (=+GkWZm_Y9X H܌15 •z;E6vSJtjM9A6^(Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((KHzUʗ0 +MPzpl>~]@KQ* 3: ҽI7g yFJ(h((((((((((4%XT2RN1@k~.~ F}WTOiM&=Su}:_˴|ϤxuBeSbW;l)W\z_rvGxUN/lV4}A&>9]Kfip~*-T1;W_|34ϲ>Bt'wB7~^^#KZKxU[{5ӳ? :?K_1tּG 5gm8"?(<+ۣF,ab#RU&y-(N(((((((((Ě iw6[Xd$L":M{9s>G;_9Wa k -ͺv Q2W ?< ǥ[}TfMH(t ( ( (:yFGjaCu5մ+oʹ3Gٓ^uσv0J%'krWi3dkFjᖏ?A(tU ( ( ("uۥHW՟pjoXjcE}QEQEQEQE/HUv4|y/+J+Hl}R"=瑶c]~_ (Š(((((((4QڗF-y>"_dhyzڃ*G}ֺOb9GRk?xV4nn~O0>֢j:/_jKj>fyC} et/VDY8W]|{B]ֱi~5~u3)[5Q)k+y۴޷W8h(ͦm= ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (<cE^3^)V>&|F! ׊~7{_,׸((B((((((/ػm«mge"˪jכ˧#gnv6aQb\n;,N*joetGF`ֿc? 3en,7|]z"=2OcZUYkKi"#l51j)三oe+jȨa:*+O%?<;ZӬeBz`"kσF!ZKO_̓+.Wc斊+((((((((((((Ɵ8W!|]>]wﺴda|#o~w`ς5v qOcڗ>k|~ni.#whԼɔO(4 ( ( ( > ~^yq}3hl/@m]LcE|W<7[xMִkoChY#aA+J59\3,"<|e>xWvյ&s//]}$(E jʍUiEf (((+?i/- jYǿPԱP>izEz]fo uj*+_^_s˱0xio揉ȢP|iXu'qm)G;s5cq? rήUMKu%:2q^;悊( ( ( (>n|T^^C Ʊkw*}' d0ť5/|+ds<$wf9,4+_Y>"O]mˏπ=n_̱XXU%þ׭N)UD{/SxNMb=G+ ?^8cQc ` .M0qIR|3 qS?t_$QE}1Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@4uf?*&K6#Z ~55[M|NUc}2t }t0 Zf3Ås9M (=((((((.zc~?g(gc­sf-!̸7q]o=~*$hx.4/5h`!` b}jXCiZۢom0{U_M>?:pP6/EWmXaQ_L6Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@8_|H=6X״]&Zo[8Ĭ܎ȯ5loYbP66ڭ*ƿyTe~|}kⶣ?RzV U,cCLt<$וfk"/3|7qe?eEhkKWZ.䵽lZ 3[Z~:=qx\bkL$JI~֒_=%bQ^QEQEQEGi/aYnWccЎ3+ͺKYrdB?b?x_/ sY-]$%$>vrOgg垴_#+oǾ>c|~tXyf~' vZM^j?mZMu (((\5_V'jI@RGs^_*Ͷ;6P95oͣ?_Z'yJ_{:ºy8Z~(>,((((((4W44kjͭ\/hw>rLL1%8-{)u#PWƟfӦH_gnZ1OIf/#;I'ޙ_q3syXv;B[/^}[},6SK.,==^}0XPY:q.I9?5~_w5ul?8E==^_G 內fPE=^=dn> R_}o_?@EWQQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE?w ~9oOwSG÷PKnX|w< G {#'AT!xҍv_{%L?noמ&k-̵ON"`exW^^ڽc4tGSث( _C8f9SSo(Q-^8D# :8*A5tT*spN=[QEQQEQEQEi46!ޟz9 ņ}+_ :tkII=ҏQ}z־zއi]6k;xmfdq}|P/j[FFiox_pVgouvOH<_x%Җ]CIfQMl?ľZps_KA5mK}ףM`s >22W]QE`QE{yHؤta$r }yű~]5GH8u zgZ?kMznvJxۂxɯݼYzxrĥњ~eM#x'3i+Νݻ2E4Q@Q@Q@Q(5_Tmt[.o.!e&O@׉%eZk0jySϰO2^{|έ׻zVK*raV^2|tylvf;fAd} T.5FkɤmH,ƢFFFi$fc_^"xn3}0)|ӚOI#l!崹i'^A]R|Ivjpß-}dעu//K]3IѮSպzs=+K4l!K{kuh0~σsrc ֵ_F[-. 8H&ޣݯ~^[ 1p¡aT(?!mvQEP((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((9q_"U=FNs%dUK_^7`mGP2O jzp3_o>`8ˊg[?{n?)ۂ(4D(((((*<1woz%Mq}^çDzIfcEƨGK 8gԓx;>ʄ-]:nsP]]?7#jqݾ{ <gᾃ=Ul > >.j'")kHRU&7vaEUQ@Q@Q@Q@Q@Q@Q@Q@PN(Os/$wcQGRO`)S\M4#4Qǀc?s~4> R`5Xf#[v'3xd0sO1a__}_Dڏ Zuyᾡ"&CqǓu#-?|ߟQ_^MԞG< 6Z$QEb{@N+sM:1oMykNps&_26f%o tۨ;JteC\;L8uֽ/ ?V $N_J(Y ( ( ?e'ƍ ⮛/P7UCC]a۱<~ג߳5o17 /d?o`F5ØήzZc|Eݟe;K9抱ho4Bk-CNU+%ѹGFA^$M5tQE ( ( (?K?b{\-5)$ >7Mg2'A׫(?k|ѵ zu5Η6Y 2Ђߏ&gar|RX!Yxp9;.ISrȿk2lmOC. xzۘHvIt{GєR+n? ( ( ( ( ??~%ze?k(a_=ļ+Gͨ}KX4ևv_b0U}N/~f|w~˪ZIl!'CYy5z{_Zyo'ގT ?^r+|{('?n|K%O_?Z;㟣kbr }bʢ_}"29W?8&2n--#Z+=㗋4E u2v,XkrD#.7[6?Jz_XZxK|}n"FKկ~5~֚QKc܀?C7_GϗmN_H QGe끳K/4fb_z]Bڧge5+naJ?VajS2O#v$_I|(R^ {I2kcZ:60..TDďƼ?翭#0F8hIYzٟM.GoV睪^sPGzPN+Ms,lLv{s|V>˟¿lIO'ޮ˫z%HMB $sH#3(%`G4IZz<g{nvT|̿}~}<5yTN_t˫뿠kXH#1QQIEQX~tn( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (<`c^:RSqfXGDQ4YAF_oA3%o3K&>?A_'~# &ŚGȣanhkicxpX8Y+ࢊ((((((((('mm'τ {^ԬJo/.oY{=Ş4t{13s-̤ĝdpГ P)n493摐0IHvxP(}O)V<i.?9ycAg/Wp0(E|jӫ.y%yN8< 9`䬒AEVgEj~qzZ@y=rOOe8.svKVy/lH]P~anqp?cie Q#8jƠ`(?F M>C З> S.""v; :Wex7BKǾ&qs˗sJ>mR[.Q^QEQEPNh ¡m;FSQTL%1AYd< 濤hkĞնĺŹ6W[w6v<@2 ]-n-$f?}PF;!3Y0?~ }r(΋Y%R>X|ܙX?10MK{_>-W? kM4+dreԵ+S9IT~>im;o V]9fjj)L#bqs?>e ((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+_ edXvHRN ,ڊg &~x=H6w4bj3j%&?x?X)'e a p<?~#k|k/j湪I\IIa:8Wfх͟pu.\vj(nݭ{i`x$`ܚn +gDs2xy}WNO[L%-QUZ$(:)}Rfa;TK@u&lLdeXf p[ ?q8tp!4H7xuyxcN"YJyN_kW_;+Y&]/qiRK5]ޛ-TqEWПQ@Q@Q@Q@+ 5|5f (%8[{cH}#+DGMuXPuki-/-Iu*~G"qU^ߧ'ULΞ>i%{vi3(gcS#O ]-n~Yy˞9e8to`qqxbiOtzQRuQ@Q@Q@?UuK_/K6Lxzwo}Hd|}nӥ58nxE0Rcx˯XO_x&A$rFE#!G ?V?gGu2kVMI'?R?X|?Pl f*0ʲ 5xW,Kknj( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( Ý{:k6>}:d4rF*e%f]:58;4??5:Z:Ih$'-? kZc\-qw{{:omwbTz_Q-ƥao|nCn@4ښ+n?9Č?~l>=tq_Scs0qg;R-'5^jV6p($,G~~>I,"mBLop=Tt,_ |Pe ^{?j^C-mR(4"" 8-Wl }B((((((य़Տ?]i0GoP׾G(O Nesdkyip&+ҿ&s6Ol^[r}ik((((ɯVo;$׾&.%db\AΓVkN/9pyXT & OqD+kzx3`cPz ~~7m. HoݕMCLc $2磡*x?zS*2ZI^uEQEQEQEQEN>߄2[Z7~9ڰNpW:d? ס6Ypkh𐢊((((('?Ğ8mw_I|9 O oOX7v?dS[Hv_<>Yv>߄x 2^}f֋/>p;b |&OgF%2&văNzOW|dYj uq{y&ʣUTp0zԵeJGܷ!q7Ky-=^(>(()v:K&&~%|I۸J_q[>ڍ՚79cqVˬHտwd &H+i:kl{Xqkb;x!!AqX p*ZL8z|W،0;HǤb_}[o(>l((((((*;X )IbJHԌA;TPW&䟲76l? Mpw]L {D&2zrŵ9|DwX6i[딚60A+C #׿`mc'5/2<F|y q 0H_2c/i;^J++^n+nK~k( ((((:ß^ =+xWY4 sMq%휦9)UV$V-Rg ѧkG~"c៌c@?F6iǠ3ws+BRiEbpʌ28 # /$f5|N'?&i,'-'' I*rs`ܯg7C-76_8|(Yo@32~{wH7ǽȯm+?hw OA vR1s0sFF8?lO-?ڂ C=(]۔'8V"09 ƸU =|+: Yb38*K~~K Gu7l3d?qdq=$,ޘQ~ %?랧殬R)JNGŁz|,!1JQEQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@yo.?/-Q6m>?n Fuݚ*G![3 N\M>;XQ_> ZЮOP{ cZ?_=fIh|Mmel|@K[c <e9aB/?8Gl1ӏnɮ(sŠ((( l5y?[̗P67=/ sO-d`k=+qIC-|3uuk_dwaȌ^GYFKLe1_“Ov2GQEQEQEQFkjciOLZ]&uvڋEEJy쎬.ph9Z$< ?ixkQ,_GՙH7 ?g|BօI7|.Q)5 .?y >Kv cg.^ ~/'7 |Wmo]nj?hOOk '$ nlIȣP4T J(4TEF+DKKDQEEPEPMvڹ)Y^IIM;Mx-ΉܦӮ2~Trڅ ֚AɰrehY>.wC 7c#fqk{wY&u1"I[bll졷8-AQFR5@-+hEQUG%} <-qv3?}gV+oH+P((((((((" FN2M5Ml߱garxg^{uu:H&T:g$kFe _ .4!g$zJE~ ?/ash>&k*FmZ?uhGpESrf/\_oEx+N曻?el[K`)F|vl(􏩿?򒏇Su~WgRQnj2?{KGKQEQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@ZEZ43)HP"<G5mlr~ƿ'dᯊ m.sc9(Yskÿ~jVouo )+` 0KNil}q~Ǫ-'[63@^~"~.yuFytkwnG :a^_8JqGf_axbR_֍lŠ(;((k~~Ν4OZL u37YC`Gu% )tq9} v >Sе?hu 厡 \[B7Ԏjs_?E)8; R7lΩr]>f?#9$ipkx)'dX`xˤknLaUurzMykڡkV(Qՙܚ{k7,U3j6}?FlO8ZZf6&7my 障ǎω,׼I_֠/of3M)'Q^#VGs\%J-'%e +B(((D,-#|@?|+!~d Gaj֍՚7<|=e)cc)uo MI/$40E.#*D' {tc8P6vZYCam6G 0 8P%} <9cW3,gljĻEiy,EWaEPEPEPEPEPEPEPEPEPEPFkg #M.=KI\{9@!f>H=n(]ahUj2q]N53~0xxKR"A"9Jp<56|OWߍ>|3"^uh;G `C)टIO~<+~S%ބ .@q L+S?? 93j3=tP#Ey'EPEPEPEPEPEPHFih ~K>i^ qt߉0d:*Z*RQwÌpxˋR>GQ,z_?4J~)UGzרgIԡZ;e;?Hսk"as^}g #@<1_o9\c#>1] Ifkui<-2l͙y[==9)}=OjNꜣ9~?e .5(gs5? NԛNx6I8ok 7wNOo}o9*D~¬A 5Lik8~8>5x=#G/ce5id(q௅hebeX0pH9K=GA"_hf,#>؉W׈x:?s뗹TYNRwX<\JQ QRwQ@Q@Q@S%?랧"ss_e/8z0+? ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( 6(g ~_ /MR5I%pnGyГ/-ϣ_̽7[ [xS,ndkeU2r;Z[p#5Δ&|:eNktf-QYQEQE}g0f2~>ZMb;h5y'O,8|EiN˚sLRQ~hha{wrJu?x-Z;oilt}>8sܛھMVb$<<p\԰қ:/_*Hq#凄;=3K>G¢O_twL=MI,J>=OM5_?EIGy2_?p/.aEW~6QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE6hhYUGpE~{?B` Z>&iij y;6w'E_TEs0ǖ=̇ GnIl4gO5/} u|I)m߈uW@#RX5w`u{sxL"'+{ڟ";?J4|pٝD8b;e8T(?Qt6GӠ5!ApG@8T1K_YTN*3O1ӽ#/ͻՅQ]GQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@_~x/;O״=J?.,R`-n_ okVxfp_iHUјjF]NJҮ~pfy^| ׼><iz早عxd`?QT_/c2tVZ iƛ--+OM_k'|Qռ3°|}>Ǩۯ4,qY]j:yw_?WL6J!'hNϵύWHأ 8 #ќך~QEQEQEQEQEQEQEQEQEQEQEQEQEQE}MY|<zkG6Snld?D+#_?\Š(pl((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((() @į4{E67޵죺= ;;}~MwcXr#j〲5GS_Q\հtk7ɸ5ʥ|yAvN~wߎ?D?k/EyœhWJn6]I{|ox᦮|?nZU沙GUOvw|Hm?Z^NZ.!o#&E9[_?UʼrJ9p??G"ri?"W_7hd{%=B8í~ROZ4~X1KXaPkND{<*$o꟢wc袊>((~-\^f:\2=w0 |ГnBooe޺.{|߄]1 ֵRLf :զA!w2@.Tg+1c{Mwf)3\/m෡X= |3o1tqc 2G'޺arZp|_3?7:.Ya2φ,Oz~鱈ml-t E)+#SݽQE ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( niP_x~&p5#qǚ@0X"3j!wŏu4E+@sO+Uqbzq",ĞmHȣbrt} d֧J=5'?'o&/ZyVQ\5 #ATWA j=7DŽtnUMݴ~]#1{W_MENK.5%@K#xX=a/-CO|E!)Bmi+ٿ >}#z5õ?MCNd ~迯Cs5Zه IṆ &:Nꅖ̻;^q޵cO/ i>ޏ=+ ep\|۬bMC/B<Ϯ_l~gVI4]"1ɯΪR[5_ٸoG,󈥾2M~G?iҶXkj*Hyֿ ~ [3UUkΤ\b_F_K-.=?~UāUBQ]cUz_5Y9?71(((((((((((((((((((((((f(GsE$k$n68ܬ=5??hך^gLreLЕYھQEiNgT:.m??ܨ&mvx@bS}y7%| q)5EyrZn3|. 5k/F/sg?돥njq=JK; VRV8>|qɧkZ^iK_?x'į$AK.q!-;EUI?r0S8K|O^fm5*Py{fwm-ÿ4I$r7\r17h3_~i5tW۾->=x汼{!<2 cn3zg5qt'9y`x?CL1sLMO Ai,/_1bG`I=V48%do7) n~.V~Ƨc8oߏIEz0G/#*[/'mFM OGeme|D?8WhJ#^e?.,>%>lyD_K[-ǂt ׾ e9̒ӵTpſ9+qVKKKBuϓ课|)`7<]HYb\]IGB<# GWgy@|I[Q_]/GKl I9n&[A_M)IuJ_k?+2I:I~x -AR7&_ou6HQ׽/ xO\BA丸e3I]M#q7dԕԪT~+m~Ο~</>(DL~ѧil7M-}A;#C&k',u qp?*Q]*koO>25x’6~O?oÏ 7:W<_:ifFfުwLGȆ%/lc>/ډ.yt}ى#*8?79%%hh>l(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((q@Q(4PEPEPEPEPEPEw%(t:yC L:SiߒQ\=71Vއڻ /W,O, 84FdupkR>̱EUQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@8ψ?> oVUW/ٟTt&45GDfQӿ꺊T%3Ɲƨl*:w9YWQ_ʏDfQӿEGOcNT+?+Ql ӸE;WO wOc}C_|>:n&>Lʎx.VJ8kׄ?e Z/1vqd y.+׽|iUOeM/ =qgiڌ[i%kZe4pO .Kq!3`zgͮ_e?P?|=+ؖmPOPnSLf?U Շ$^OM3Rh ~ x7PkPܘ?.kiWTG# ~N->#H,<7uv,R%#!_`_YĺTO>6\6[ߖI55{yEWaEPEPEPEP)Cx?[4=/`kw,%i"h1FjrZ*QOTך?24&e f\dfUM@V_?V8RQE ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (>H3GKyZ$WHu23)5+?ش|UTB((((5ZY?i-,NKLl1Ӂn³_g/\Z6~*=g3 i[f.T%VK^ j-J(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((ߊ|9;Zίʨʞ)n?|Lf:FG_O zKKSS)t_+[xO"M@V_?VHQE ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (>A?ش|U;|~h((d]??o|^-?:O.m/;LD_{?pc?C ?oM|Y[W=ϊ^}Ohuc!z' ?IhG_aD/D4:$ڴPC z_ _V-?ᶙwId1Yimon8UI$$]EQEQFk3>5Ѽ# IjfrwI #@tWyV4߃]!UWZ%7QVz忝cwkyd_@Er>9+fЮ5MsTӴm2Kw}rB=Y܅k㟌q7sKWNѤW/\.-! dM}E~tqo[dvU=XK~@׶|~ ~87 V=eЮl BxsҀ>99C$ep{8"QEQEP͵rxOj5ύ ЃRw4qΩ,q׆`h?U;EZk3.sc5҃@fEy}|JM6^KpLPʾ$c65c`Yx;WԌw7 p{c W翇ؿ\>$kFHU{}|}N+'[_i=_ے%O(EPEPEWu[]էz45k#7[+) Y>}kIQU#0Ij(5࿵SnXF^pW=ިαNƦ^V!ڟcߏ}/s 3z:_ÿ>յ4ƗIԧ;P}%EPEPE5NHFihԓ 诗8ieO_<EŖzuHYgnNG-iמ]M3<Oi F@W玏J:ˏ%W\x7Ve98Vxg40Um^O(|u#^ocCGF ku'Ol{~m&;Tk2\YܥN=C) |OўV;'gOQq4v(8(((5:uMq4V,8U_'j]x"mR+Uoa2ML"ѩVj(7JGOE|.[jZԈ;At_p#ucTo.w$_6÷Q~}$x'y +ֹ-n?_;$~bEŽ=Me׬gNf<V 0%I;0+C(wh&Ե[Mtq[0;rM'$P%jQ_,A_owPlt˻gHI;3gnU$|Qnx~ aNk>! [_}ExG/)o7x{wSKcD}?{S,ʲƺ)օEx4sxR.ҋC98(3l,1*'zuj)oM9Xn > lGLR|72 ﶐KYG۽EVbQߍ_~3ov&a-)j*T4Kr}"r*+k 9w";xTOmQK7ڤGqqkIZ÷̧'⹿0׷:=#9yW\߃__dW36#-og~s$CJ,]P=ү-M5z*(*kE]\Am4i6W/7 $d+jpAVƋ+điږ~ mPm&5"MV qiyhQEf!Ex5/5<}iڒ:I|-@{P=a~_[[mK8-ga%ãPGv\ƚvaEP ((3)b@U$W|] H|Y#:Mg fڂKw~#-)?~mYjO_&ֹjc(AS_yc8ǟ 5BM}xD}c6G. h']gwgGHCjZJ)B1FZM}:+n{F<0uR&})EeO:/-cK֬."a RM]98J嚳]Q@9!Ef o E\WۏYZYN2G_Z'f!H]B8l~⸳ /,EWہ_GQz?Z:sn" ~ݫ?7з_L(ۖ_kWhܲ__ȔIv-QU,e?ƎdZ`g~%}^ux/죸t֧Z?,җ#Vv4*NWLbIQĆ|#=>+s[ۖ_kWjK}B D3C)^6?*ҥxDt1cZ96LFh ( (PE#8E,*$~\=$f6Apoܮ+:ayՃqsXZrE9?&{%.>"cDxvP%Do~Ǹ^*Xf񞡢#Q72$L=مsha:z\;U%ZW73kxGewHPG]&k2RWGգ:St&5fG%#wdu__qё|Vc?S3&0o/}}C] +/uS@pOU;&QE2B(@~Ӥ5/FwV51/WcfJ3_gTWƷ^?lZ牮x~W>:,?uZ. %.}0sia6Ԫ#+]f%MI`:ޗ=9{P=?;+L[.f+>{mBEtSR~3dن2摷E<Т(((((((((((((((/GG_\__C QE~_s_e~PD (Q@Q@Q@St|Jվ ~?<]\}]σmONo"9^'uS'xㆽ6Ok~-ծ3uy#;r[2xOA50OEDǭ/.&i׍4} REx;RV*vX+v:kYGR.?N۫pjHxTUQjuwq m4L#x $ଟu]mgR V0^<>NA[@|k_|-O^l1^^@Z 7Hxe+Ǚ:*_҂TN {Sx5k1ojm9=Rvƾ 袂 F :z=EP7#/n c+ >v[RӢ쮟,@$E)1#1J߲W_Kv޵q URȼ<3F~hC#r=uE{ZMO먴ziO1m'$c-&s_W9WVoį֬׏$G\g[ON˜,$C8Y'9ܩ?~$I=I=s@${|_ZڿO(6'81cQRAAM%6)4('{oV+OOC _5}2,`D_`*?/ { !|_੤m9ZA`HGߍ9@ 2kܿ?g&x^kŮ$c4a[8rdDafZ?+9k@~6iwݞhĈk 9]%Q@_xiτgm_gk8>Z;NyQ5YF$>I?Z??~_.}՚r!e{ uGOZ4Vj7R\Ysdܓ2x.1e37[BGc? nots!GU`rXR "{ߴU\?o^-o+4~XW@m0z< "STvwQ_Z4$́2:AA"()~>>(ɢ(n<7oVoϲ"BebT\kⱤZŭXOO_=hixƚ½vSƫNE;*&GSmѐr_W㾽M7 xx621{lO5ql_//VX|yD(-fOi<[Sg9>z#ܿr炼M|H4~9,{m8.!9 XկxUFXlQIUUG@1N4n,UYOb2 ?4P~ȟQ zbegҞsutx R5]/,t߆_/m5hf?rHKZHG#:d#(uf .=oK0Lk*8Ҧc~,q|̠(q@5_3u㯉 Eao.m62 ;9 ͟Qj~~>\E!G;cj噕@$_ȇ 3_)/xWMm&Aq ?WlvU>Пk [PH!1B>\m T'ޯQ6Ʃps-IKQQyYmjhJ^rZ\)#猆vh?TtWſƚ?~7^K{Zm״DfYsţw.ݭ"4[9T2 _~t2'̿3oN_:ohGx0qh&GQE羾`xgA$ wps^A g _%bBod]x}s,M:GОCuu6w5]\9i$,If'I$ H{|!DV^uMĨPdg,*?"{Z>Z[7$#g8 KERZ(3߳<x7VŹ老fn`+ d֝?N?xvB'tQvun%ca$$IҀ|5~|Q]gOuulf[Fz2{:8 ܯ _~OZ­}}=~$'S+ F9b6QEQEQEQEQFh?j?'54JA߸ p>gn8 sYeOH%,,#`'.G説Ǧ+/ 6ėf)Τ־g<7uY|藧Kgq"siNh;3Ͳ<gKƢZG4D߱j^u Dށ΀W'вs{09W'ů|x:֋m`nad`U + }߷#7źK}JF`vMy0ɵ*rW'2VM%?{)wfsE{^/|~$@u7FlTeO3x++Ҙkڡ9-#PiTWA4i&g_Cڴ}3{V':|$ 򏺹c>]sG;_zirN 5fzMuoccgMqqq (QFYTI< qco k~ o>v> O)/\2K_kg[ɚibĒ;c=j?߱'aco!)gg^j2  FI!W#$dW|@5!_E4]9Bv2 S䍣'8_T|QwiMZ~0J tH'$I8hwz%bkeSQyw]B~Y_֛IJ%9mv3܀'Q#M<$v;rI䟭WRKn*ɰYeRTovl(tRكqo!hXwWR pk7 ڥ~*Is/Tڶ;9?4VkΔ38MIt}cӺ?/>Ѿ)7Mu+McEաϺ)  A:B?e//Ěato_ O 'nszqc"7U?xۄk?|%v~kg{4-Q]:Wo|v7?U7Vf絎V?j5b??Bп{%~8ZI_ɤ[d o<`3O}1ӸK:C32fcw&ພ}w߆v>45SG` 1c*+* uIۻ[Ĭ!\r-r[*Bj:tgowַ굺O.qc+49 @<1͒q'XW S Rr|wgxL IQAB+RKAET!NK 9cPÑShf,Ư٪o@}/_v[냖\UW9.{q+o&b2^xzELx&xxc|Ic躅擫is-ͥ夦)Sea 0j׼{?ӱg:QTktUފ/>[WJ/)D׀e|I5į ["k[/"A+2Z 6?s'Gqz}}SZQElyg=o7WmnckIdBBιQj|gε]ZIRAtE>VFRAև%X{ _B&Dž8];zHXqhאXkkZY5_/Y%M`dy8gSϺWffff9fcbz{^a[t>o?)#gI=cOT˪]?X_xe7al:/ǩyڊ+e''ynFappԕ<bI$#-'A78a )\4%4m,FUzo >uyfZFl,~=)⿟*?gğ-0<یLE} Ky@ꎹ 09G|q <*Jәt.Eq>5hWt٥@<' 9d/8."ɾWm#ҿoO+WbCOL|x+ZN#=l0` k|dn#}5WW.ei2I3K3bNI'&fk]ejZp9NKN2PU+uQ^ljFX2$㩧PN(p|Rf7|U7GG0Oh 8o+?&E6YǨiV(OC[ͺ/L{J>I4[Uh˚;WtI-$%>ӿiC𭎹jVzD'I {#Pr+ o+?bPh: ې5 f˝F }uQ7+Tt{;o,Y ÆR 5tqn6Oc=GNZ]>]W[+-/k5I;}q'ԭtmܤ.f(Ð2&G#~F~!"$/qXlO2mv1<-1)'lh8 Mye/|={Qw9O]_k k.b֦$$Eh<0%bI,Bp+Xꪎ pWT)˚n˲&੪p]E'qw> sz^6XNйc͑_O.nRfZxY1<-c[!d9F1]|UJ]]G~377wW4G,B|Y!RbԠ*6 q9zEokUԵiy,򌪖]RJN2ꜛN4jWSS)t_+ l}?h U4YE[#zaFhZxƚC*kVZip|c>;QS+Y~3O G(zɤr߶[],^u7\дV< >oE5Eq>5mAsHGmLon-3kGPu+뛋۹Zk2K~t.rqb@ѣY.EPPZ^ ]MSú1sܽHYPLEJgaBDl6 P`0 ;̀ /txcT4=Z!5ݻnI GןHoKgoQxm/`t,W@>NJ-{Y~i8ISnaABSn [tkh )CN?Š((((((((((((((?o-#q|Z?>*Gh*!EPQT2ƦkQqyeyJ1q~U 2CPu("m"mPGuCo? T@/$//4P-~m/ԝ䉣8xEY#r2GJK3~!]/I.^K=?VKx ;ai7*: RWQ@>ozh?OA50OEDu 4QA@)3HͰxOjpMaOVg[aqD0f9P?d|9{ħG庎3]Fx_'o@:~D𶖿zD N3p 'o |;>𮅣oA#i]vq>ll䷸9CȡE<Ah'îTi573@?h/Dz'Em|]FK"YA  qCy-@xqA/հ 4n@A @vc8Q]ٵ| d]vHu'h$W1~?c_Ve: ˖$ҶdCԼ}kѱA3;Djx.ۉC/* -Pu~a1Ԯ$^tӪI_濛4#xK ' 0 `3-.bqǮٟjaEP#'@<_u~*W%y6U݃v{:Y"՘rO'?|?5Lj<]⛟00Vwv'#Wws"3k_C ӼQ[7;ė>m c |H(`sH? |ƙqQC:wY?WI_|!񖋣ۮu$]#8儺GJȪ;XmhheRpx ҁs 8rN9_q5/i8ZXudQ]@AAMD**(coylo'/ ό\Gv%͉}<ƯOVsbG+S?i NRLˤRn4/oo!^6KNC (RB@ )D?jTFi1KEMf9 JfٷƿxSyvѝdW1H=ndo ĭ'OW"3htmij+WE} ϵe0&O.6o o ?jYO,[\xrёGwy^` o$Aoio<bt=,tw20IeH]`1wt/5YMޞ`'QxkOXt&+;;h""EPUA':e O~ Ŗa}23$tyр x_Pcm)o(OCy߶ݭNcnX<Ϙ+҂R;г$ԦB?/&5-τ:4Zܮ(08()W4|J7#[Ikpr 0d1a#*CW6@Y4̸{c]ȫӠP95 oq }\txRG֤8[qFgk{ 7Z.qS5l-J[ȑ6++ෆhτ>"/4}g>*O,@,N1z22Uers-z,_?k߅\MZK8.\a- O F^:}mvT/.4KM-ѰdOfV_?G(4IEo'j~;,d3y k Ѿ.WIut~ŭxOVO}Z9",G_Jߠh=(n8?7\&uV!(С2?=5_Cc#fOLM ./^kV<|EOյr+ >wKw<8ym}xgEGWz#XjtR(e; pA̐c4Js3BxWW&I75u-?J{n$ l?`A0igO澯xe%yl[v9FQAQ?+^XAi$`eP:O~&tA]g !0$t\s_G<=--5 «D@AQX73@s??̯_E?O.6Xkò^=\M}WAg|/$!2i (N=~Qs5]|+Ӣx5~(џM닸a29_^𷉴0#7?-17ƚ xd~QEQEQEQEW͟V/Bo٣'Vc9ֵp-U}1#dr0jʵeJ.qX*?I(~2~ؿZ]K&(?%)=:~=|C$W`Sc]ҝ_RI[)(e:x2 _~mQhO?nWR_hMV;4nņYr;SN9T7afl ;}fR/M~xz/? X~t]MCkggP q5*Y4y&ߑݚxݚԬJNd/_rOEMy/,Wx_,JTn=RsFbXCu ? mO x@e m-J *Fqb2;+ї}Q\B7My'_n3/} xuD*qǸ+W-zǍ|?3g:t; b3m'_HٟW?bGo5˻sR|36`ón\U &+q_ᨼ-X:nhⴼiMKGk7^jڍYrp9c_ JGR]#~KR*'?n%([(K|2|pӬ*$YA/lbc=f28r DoG?ؾΧK#Y b+?i~HK` L>Gw~[9yZ9T#NsI7C~ /Kw.oOq_'ҿG+yX' `&L'ѰٯЌ񯂴6XHZ!,7VSUlOG.OVqFcVlekO}h?'0| 2DyZ;1RI,d S98KtLe91Sa%xM]~it[?bGCNZX~X;5qݗEA^CAS8J;ln/<.!sBiPk]RP;im4n WCo|d4j~} TϲP}O YU?ync[Szrj՟++Ҙk (`oO_`?-4QE|)f,nrsڀk[_ݗ'Nx7#5w [MӾ!`÷:OؘeԐ]Xc.$[[z6ch#T 0;WgZ<|g],y|jN}k%ݻO~#|7./;jz{:HQ:5+f][Jm-.T,$U=Uk CeO[/ķmiG ycaCz#&*ʥB>.+|W_ԗӼdk}iEy'2=AJPN>2/}\xcLjo֏pɞ3 mA|QgоYϰFR_ MTMZoMEW~6TFrs&?c%5k?h:6.V5D{Ŵ1-犴O/*=|nA=O+i_ڔ¾cU v*AzJI?xݔ{*gR h螭z҈bf? />W >E(Aȯ S0j.l#eEX,'Q z2;}iopīq(DQ@V*'q_ap ^r2KF6ՒW_o-j<]kvh g1*!84X<ѳÌx}2cuq!K1}L~~-ޢxPyRIm C=%Eg8N|!fYгG7rK8@ihPq]&t:嵱lp*O%mc7B6`|dGH@Ǯ$?2_WþR*ʟzs$9ڀAO~,L%?=>(15xdk얭?->?<_uj2mnoe f/S?n_kKbO_mKK5'rx_h{%å1q$+w';#Z} mcK#г {y濨]KM4nẵĈHR0UAAŏ,~I񕯎<f־Mцk=\~_*0@ Џ~>*,U /+6ڗmZ{h4P(?g:8:8X[d|sUhS 'v1_[6y %OJrv 3ֿ^?xW>\4x;Rr};G\$I;W*'?oWƞ'-mM{ZR󄝿 5oV~QEg~ѿo^<wPi+8ʿ7Mǟ.M%4VWŏIx?)PyރcSҾ[$knҾG/, ψʒ K} "*?:Fϒ SS7>X/.vI_|YSk? g\%0VM6K T $WE AMk|9fsOq#Q% Z|)Z>h+[Hq1ĒsMtDFꬮea>=}4? x[3^YzYsYH` 64/'& &O鶉 \"G?xʮ;aɯ8g08&F?54ƒV v=8 +'i?2ulgȷ2~:r Ùfxl ,^2j0ӻ}<> ~ kkZJGנx KR[;Ϥ3OOjeþgi.'y8g^<篒CLX`)>fZG?6 FJ)AhLm [}/m=zUA)'8w1XY/~<] ְQv^/ת}^ɦQE}Q|{[>zΞ~3%Q$@}_uk''&mCIt"`?QCϡ>?U5G<5F>.qeV1/qoQHMz'~}g6k4Hu(PZL]Gʇ+gOQ5SY.^v%w3{WpG%'i᭜+4{ 1Gycq[GOS^]Q~U~H('eRh_ Kfo^?dE2O7aD7F--ӱxzRY1M%vHc ۿ6~j 7S(0fvq#? B$0Kmbh Kw=k도 4  xf=?EY;n]5}f)ު*f"KQѢ)-n'eşC?Ķ-ub0+!1e={_C~_uIu;3^ZKWӣڟ%` @3h|R6y_ty'_YTyUX&]~icrW29:~viu&h~MF1q Q'̫U(Q_)է*spJ9 ;TI.t׍SথXi5N26ZMP=|2d׏z' CO&\m-nYDOWFWlsBau[߂so~g:WXXb kO픺mz!.* D`}OIfʽVy>gW.QI'=˟2RCx7In?~ժx^-w:kxw:kv1/U|#&TJ=y¨Q;v[rW4Pm |QEwc^NJ9G} bW; 1G#%ø(bIT-n>)П .-_U`?x@k .-G)П5QG x@kj |QKw{YZ@7K=ƕqQ ,̀өXYt|VB'Xi'{ψSΒ>['{]Š( s}Ҿޯ?acJz-uCQc?䂑K^UfOqd=3" Gpd*1]$'>c &^m?[O ~tjs0GnG +Iy\jRi/WvB+gM{xÊX?uant}1U#ݖ~#OJU>X6%o<GTY妟l|(8$g?lOzq/[hV϶3__yv,ʭJuYIy W_CG#oRZǎ8q(G٭jޗg?sG~xº.$D5 Vfq߁5Ƀ_g Z  Mk{QGP"ਟI}C=ƾ fiGuWyUl3qcr\?>ׂVgV F[OoT'{w>>2mPEb~?e\Anh _Gc¾IMocpgqSS`kjh/oC^ՉKii(ݝNTyku*FP3 ө ?E$4$XPnxGNУY0=Vt$z??e5?2u umDeTl?_ *U )jGF?r?-|&j4c䔟?6m u|Q[͏MD'NHp?M{N$O3V_eiOdmy9_Eo, ՔgCN'>wqO%Ohi;~Ϟ2{7|q:Cz,hS8"r!R:k ,igcmElM;9u& B|!_hۇ|;97[Kq]F_,kMkko^vQ\gЗ/㼟g?Ljq؝3P9j;WW6fh26Tn$w 'ҿC+2xx?.=a`6%MQ]˅Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@ |Z?>*Gk?ش|UTB(GC+ߍtӦJ[{vydmVzWACOSw4+K E_)? OZ|WGm__->MO8/tzMZ?g36w'~FWm|{Y?J/ٖgEmwY K$Qǹ(PY1,_(!Q@>ozh?OA50OEDuQAGk}oڗ/-zv C5QNʽH cd;H(XB" ڨ 6?-F4A2 (O%g?ڿ-~?sraco(G"ѐ-licvVAe#O^.Y!ռv[ J|p.dQAG֟E&|T"wO|;ii}RY$r;n,ܐY >{í>t xv; 7OM@ ?9$I&?3O?貂dQEM6YӮ,K[qaB+ 'a|R#mSp@; n=T{ c#BZVbOAQ>@(( fಿ㋅ҵy}2D:Wf׎ۊ"[Q@=K`mG__z?ӫVTsL ݾ* ʁ75EZZeՌo^|b6M~U! HAj\?U Š( _ t uK)B!XGnV濆P7xk{"in[ni$Xo, -QAG<~+5c"s$k=S}kb[7v~զû;|u8ʎz| o,Z-B $ʼjÃނdjEVJ' eWҧO+GStOWzk%%*"(噘MA_ ?WoCG/P֬Ra.;.Xg{ "D:ll>1x%F~h؟q]ʄރE++7K4 ]AΜ7#춯g&_Boo)n4wUoxLӥS%2NI#۸cm[khQBI@EktR YcI-ZĿӹlo_Y_'OM/7 OO]JKk%dhтX񹾦3M3Ѽg I _o>BV~Q_?|3GF/7 i?!P;t x¾3-ӦOuouunïzZ eԿୟmS:o|\i+MYzʲfhb+a+z A_o_o3. ,>&{b0YH=3&Ufhv3c@3҃3~\h߶/3}^R-=+":?x^x2^i6Fqԑn\cFVނ-u_5xrxGP}3"Դ,aH*xebZhgE~ B|;z5br!d%B̍<*on|=ԆЎA⾾_D6^?7b@]qZŐ<.[#"ǟY{?"_2ߋ?5P)l~QEQEQEQEC\79kd`w>"?+4{vǨ]~Wo+x -Kg|~Ҵ6.r>@x|n8{wi~(ԗ?q-Q_$\ )oc?boi-nꚵZy.@POk~PYIX l%%QmUQtWRQV|t 6ܤ%?uQ_L6Q@(?es]r(AL ȯ8Ϩ|mc4;L=gHG~>9pҷ]?\4e[Mcrih4  x쵨x.1WV壉A/W%puI._ d1a刐-Zy#1kiW}ߍdv1WEWF3EO{cfc#҈=^?iFޡF?FO{PǗ}m%qRjYRٷ`cˑWR5;32L''%/y4hݏѯ7?Si xFIXCi0qG I?ݔW}0x? WYup÷<oc+2In?|d*@t+ᰯǿ8Ns--_xŹ?οݾhC)iIEWȟ׃S̚gX@@pO޿z??O?4jZ@,i> )M8ؚ8\> N^|OblQEHW+F<Ew4% 2zꭆUAT+ٚѭ:U#VOZ01߀_hW}Mc8=w+6x?Q/v1#۴umc敆}A*CNcV3G#/ 'z nORy[8QEcH,?67nEWџ@g />hx: p{Y/Ii{ᇆީj=M?_?8kKOo1ʿZK_KR7ݥc+ o~)^[Ye PW|v" |j611}[IC 5S x U3p^WkŠ(BiO~4=q52U[ݠ-̨Ot5SR qpaEPjIi~'Ko#GiٟߘLDq!^;I)/WٟALi;hVmc5{?ĭ?=b훯"dx|/5?aV'%}iQm~)Q_| g&u&+?]޼ybWEgp?|}X~?C%W~}_!>4^^Y}Z&5daFۏc9n?u4.D-lX 1PFjT~g.|`+EW}fKF1êw{G7ٶ'0e**+d߫o~.EW~Xs?|YMo B~ tca,lzTuń[K1FA/*oyU/_#;0gܗO9 (|=ukk|]Fo ee|-OޑQ_7>Kt4GCooݏVv9,ǒI&>.lY_QъuZ˾6fܿu(w}ݴ]ۻQ^8h؟'ozsisM__?Zx)oVUUicxfZWE{(z~n*qͱuʟ3&|EW̟-5F? fVE-49q$2>> WCcE_5}6CO~:EjaNJ_ vO3 Ǣ'k{4^̇Ѽf僗mOw^(y4c~&Nj.OkwwҶʁ@S` !]ijc{u~}vg 1J4iJJsGf."jq''Bk+?'U?ZN3;eԤhG UkRu6G_ytyNKNeͫims/"x?}7"Dgo1_K!υ?Z(şI;'?w?p|/q#Կgxj?Zwq=z_qn6~ Լ n=^YnI.Y8fƉF獽9Z´*u)Dxu4|?vs ݂mӿz+ r悗tx>ʼ+kv o E\Wܕ&%cc]|~x?^(?B%'?F=>)? 1_'_W#J(] (>u9+%|UgsVJO՟^Ț}D(ɇ7w+&14Xz<}%3H+/wCk(I] [P~f%(';ƿ,75{Wc3R?|Y5vxiX%ӖN_\|)h0 nygX3-C_:|>d&=yҿ#mz Iuonc[~\%} )z=.z^3fdA֚O1{V1EWUu}*\omlo!h.-I*R  QCqN~–x|?8o)/vriX -؞J#kdvJ) {#Z\m8ӯ(Gḏ Kr&~vZP?SW$>YE["=g0)QFh/i|';ψ#bo%pu4˃~3.}ffֿOv??/$_Ϝ#ư_ $S)c-6MF UGO>&p(/H|!Qַs[ttte`~kG"PGի9C?TW?ې_r?4{ǦNkͱT.}>rx⣙R.ݷ[+?d?S;EoǗΑ(̗El7t~W?l5SN)۟nEW~zQEQEQEQEQEQEQEQEQEQEQEQEQE|;|~h (vbW;AQ (2_ bt *EP (((_O ?')sH&F 蠨((͏1_QM:u~W&/k3NEP";%??JnOOOPҩ(*'9EPQr|Rr6Wr|Rr6PD ($p3ڿH/LgO ZD(o6_S7u6WU_ʯ/)a^:n+nQE?,W~Xgk?NZ Uo&Ub MxkE?E^>sOhW3 ( l]; IK.4E_n-+L|:Kc̗Be2FIg v`(nL?J?eu_ُk kH8濉mhM\ֈA]58O-cR\n8%QA'h~ПP5*zQ?hO(=|AW)xWZW ~}_EEP@QEW3b:k\4rj^2.ؘGi)$wr:_hq^ſ m?,#-%=JPhPM}]_Q~п ZIÌ?uj%G"teܬ;ӫX ?kKK? !?㫶{!JRK2J 1 |bmO#\I㯇΃ `xB i2~c*.Q(.tSRe+++r9@ר~O{>&Yms:ȏqom9k IT˹l:FI%JkxG %{g?V-Yv~( |dg$ébX.. >yfRn4GO.mn1m*0drt" ?_)hxhf?4_;: 6%`]}EPH_YMY<%_2 k"2sB9!C+8o q-<1XI῰8ȁyrk/:y ZP/. BVfk݉fby$ H~y>!jhdž|1+O`?O?Xدtp>K|F܏p+3~ڜz?c(k9 kW$9>¿_KGG r?((‚((?'4f64U6?~k%٤;.R'=GگW;wcZ$C(L+np}#cW.[ڣ3%KԅJ\$a0FO^ E1u+. DVw_A5>x6z`=|}> grE_ .MDٗmw~/ݯ"&!+8n~*7:Wd?$yI/.a_8\_GW?WG_0ץw( wɼIcX=~d$Hk~L?'%8~lҊ(?±">׿qڶk/{-*|Xd.ou%}]>?Xoc 2+ {iweP)/V(?Š(_ !'{ƫ^7^cUj|L[pPWןCH?_!ןCH?[a/gȃ^B(?9ط'~W['9OҖ':v䥧'Q_"^>G:k1^G:k}C_/QEQE_е 3&ElG}ic/GͦeՍr)E|_<6spbk _}CIAN>#}Ԗq4,J Ϧ? Ȼ״_Jm?Kf ı:bBH=;ɵ+uc =Ku~?p^:J>?ga㨢@ fF_^سw`̏~3EpQ^8QEC"7!g=K x ѯ9Mhp5\t)$|~U+3/[X[E}? H?`4T MQ$}I5N}b=o3,xSHoy:Qk|5bŠ(,(aQA4TX6X11a'_?׽Q58_(7i#Fs5?YzQO}W~r/¦FdoKt887QEyz mx\g*)H䣀'FTQE~g&u&+?]޼ybWEgp?|}X~?C%Q^ȹ4u_Uȹ4u_UY?~?8E'ybk+O bF_?_QE~ k?%뎗j-gqm^&}gyL^(?fu|!C蚿'W,:r~dFxoTK+ n@1a3n^^NRy|[EeO/NIDxr?_a;vG _ ͷ (+ {BԼ ;鳋[a4HWp_Q9Xj~5i/y}_:[gL]o#0u~§򿹞_͓]/>tK~L_ -D3&.aS_f. :Q_Eåh&z?GadKGϝ*; m&O_Gåh&zװ~_C>)闟4|>g[ԕ|Bv )$+Т(_+?WG_@_VG?olYEo@(ڏ s}Ҿޯ?acJz-uCQc?䂿=Af~;3,NW5W/qH̐˺s=:wJ?%tQE|xA6>v_ӿ"?6Gtv:er%Qӥ17LB>Wă<,L5=;cteo2sڽ^~YE["=g0u%m B9Օi-&s <m;9<'xxq$oDS9#P'CA2?pQEQEf3EQEQEQmݻ,i,R)WGPtIE|Oi-楩x> e\ya@mcZX0Wo wQMS5h\99&52C0#"cq"S[A"_{c)gK}7>m_Oy 4Q¡((_PXWG|h^7>^CKЮa ,P@A=3_vK/+'$-OLmS#ѕՇ h{{! pfmg;[nOe&Xֵ mrY'yerYvrʼnߢ+F8w??a[{_\]~&+da?笥,1c`kO _,qh [)%Rxf^AWX]O*0*\0eR;)5z=D_?qσ_OEGhZr1Y탯zv8kD,|3xx,-17EX?*ͩanWn9a 崹EXsE|i6Dތ?1_La[M|e;n︘s_~#Ԯ=CK[HUn}LrmlzK(b9_VɓM5wFJO/G;7?L4(~8xYK<}Hw&o_S%M~}?j> > ̆5dMF'<$Xec<겝e7#aur(=+?h>{|&bx^C b8G5mӱ>4+ +'g?xxV52`ei3_`Wdpɾgϊي%e>X}_M?? Ja+ҘkS/>_u~EpW&MO?ƿc &'ןEc^Kg~19/gޔQE}qI`ճXkmQS~~g!usFf.ou`6FoW_m?MЮ+-zπKI|W?QE}fQE:Q?5^O(ex~{SgG"?{E9`KDE9`KD x~h8D?%QE}4xŹ?9ط'y9x?%-?I?=袊Z?-j馷K2 mOGR{xwT| ^-'b2lD)pڱ;`c˙QK{Jw3z@rik尤-K_8Sk[_'FT'#mA .?{ܞU\UTKdwyml~. :%}p|QO?ď'mkx#o*/+iay%I}ke&CBz J ?f/7_c΂r(,ߌG;}'W_Y>P ^Izۇ˽b0C&Vڮ>zv9`F-Ivݑ(^~?p^:Ji?h8/_;}~G30qQE| }^سw`S/?YѰWe}fG_pB(`(j #Iskw9D!FKݨ|v(O ,dF *]5!8/i5[٬q*nzy6W[2RI/K~HM|Y+Mf1kƻ`)>QN4RKh'm(dۺ= ;Ue d~?O)y[σg >|D#j|Qp.zn~QEG~ѿo^<wPi+8ʿ7Mǟ.M%4VWŏIx?)QE៽_m?JwUu_m?JwUu_eGO*q_QE4W'?a҇j_+Nǟ0Ccx ?9mQ_:Hp}7,]+>.lY_YW~3EpQ^8WRWnJJ /MgF~jיtϕ袊co'W,:u|!C蚾!'O?goJa^iexIy(|Gj=OW}SNXӮ-.IouC*V^HAǹb!]}/o(4>6>KPne^?hUcV 5RIG_m# R1󣽳UK}h3:Y_YiK_ukyn|?s+$3v2'dk/#'=,?q4)+EI.I읏ݪ)斾' ( ( PEP_ _bV?5諊a/ogWǘO_"~+@ 5?[>.sxG/&o4ٗv⺔>B-{#h~G>8Shl3>+吢(_+?WG_@_VG?olYEo@(ڏ s}Ҿޯ?acJz-uCQc?䀞+Jgi۫L?c1_ټaYQ<#[ |9VKf3*aͅ4vxiXn%]d~-4P(?aq_/\`rqH?1_~5p#_Ѓ+u 9 Hz-zEe BO~0d.%wFJ횗tߒ?T(+|w@1F\ zպ(< #KD&*pxNN-gW"^poI6>k^{7mT񷊮KAAm?gӭA?£V$ɮYU*fɪY5 NpZk_+mp?SW4>YE["=g0+ki4glz_gĿK%ծ ƭ^_Hr1'kϪ5Co?r/ N2[1nf5Q_4L?xӡ1+zԥLiM!}xH_ iDdЭ|M@n|A@O&9U[tEng<Z>+xAivH渒N~QU>{yXe񃋱RɰpdI6f ŠFsEa.75ѿ#_4bV$85sl~fo?C#mr +C+ OEW_mz|f/*97ůC_K@JRѱϋ3cozh?OA50OEDuQAGElɋZiӫ ͏1_QM:u~PD (Ǵ_7?,1RWuxIAQ9(O3O?貿?3O?貂%QE+#1?-knWGc>:ZH-*'tQE{򙿆⿪ULq_UKp(c :k@<_u~*\v (4 tS=rFъ09 _G:Fo~ҍMhŨF>i>|Xh4| ~: :)x6D&ZʊF~x #8 yocO&SQ "t MJ@3刡cY RI7zN%\ >XmZ|? Ț|L~in]H1 (–o(((هoWAxOែdvO^uf>kG?my5x<ѼEv(̓7_I 9ǚZ Š( )D?jT} h~ПP5*z@5SRد贯U?/J- (( Dȫ$r2zulO?c;jou\ tɖԏPXJj%uo?Yd.%5;;t-6>|JlۣP3Ahuv Go~!Tm^vWwݚ9񺒌V##g|#x;KԴ|Uhwn^i;`{Yr?we8x}6mK-vXBSx(p8_WmL~ؖrB+\'Id>dk)~4<mtaJ9tɎW(VVv?j,['+xmkPᴍq%Ӭf7gڿ_rw?nd5W/A1zW8P3~_ye,2e5ڃAX#By~7!xg6ŧk)d=Roqa9738;f`B?/$ tP:PzPIp4~~cҴH5nM*[n$q'GTR"H@8''߉~X K}&: KMj޸2w/tlXog`l{d=/Ꮝ 'AA]wV# GPx 3_ķ/o7φ:_uF]RnTrhs&y"WŤ6y (˪bC34iq܁OYmiwY<5َO ru/< ;_.eLaF}v?Lџ. ^ly^q  3A_fGAO \ C].`yJg𬷞!! Zʫ϶;d~׿9Ƈa2NL]GݖuEUԐLh2}KAA x4-B?+PK:33e"86?:H|1Jv.ג_G-h_iߵ?K54틄@)YW9_9ՙee;YHG @9?igVAш%/H:+]wJX׿x+w?aY4ڂ9OxOyz^WwS,0[D,B $ Ug|y5ß0))MゖyS||cEX3a*F/33#*a^Qf _2ߋ?5W_&[*-j((((U~Β~п>oc! 2BQl,H*!qUZnK'X?9)/;=kF.hQu}%F.bSP|yd|=21Œ{B J4b?Q۞D}qNz>=lܟQVגI%U^ERwkHfVfnIW~!i&@.0r[Xԟ~DG4_'^n'-a [y=<ZgwTbJڿ]+9xUAǕ8|$q:ȯ8f#aq50^ON_5 ºVZjZ]̶WpH0MF#Uj=|3?i?GoV,zry_*59t?xo> ijKxG>] ;EM״sk0Ď)EsV7*҅X:uqj=SOt [~u URGq&-m+`H_:q}..#5x;O Da]77?t1^m,}W2_7toj:>G_,v 7nf^oq_oc ⻲zzCKEWaEPcUd^FW>&|d-׸(+!_ß ԿA!_ß ԿALJ3ASYEWA_qo?[JZa+-'rKW|R ފ(?ZO$3BH䍊lC9A)f?N]v>-,3$` ,' 臂?jt/CR7=V?BWkLz|޵8<s )8NݑTon/axU2`t;~ɔ%#]kcFhx.DqH.?Afc3y5w:SƎ#.SMr]I[3+7P-IDx(z|C?q#+O7Oś~W'ybk+2?w$%%ÇQE{EPG|g:LJ(?Zq"oe%uld񪟑Ǩd* z+G .^3_6ix!O{U+;ٳWa\骱;3x~e,!覶k +O|Ex?Z~\isKi`{}g|Cxj?>2MpMzE!;cs`A~+2J*a>O87uK~4m#XdYbCnWS ԙw_yݡ𯎼ii݌myXPyǎlZTaǗ{~'q_ Mz yTAY O>{b>,>2]xj @VۉXYbNaWqܖnI'$ӫf1=c. /փu+5g6e+[_(q\'YYOCkk ]\Ȱ QI''xSj%Q5̗'Dc?6|M#Ƕ<]oG-L J}p}ßLuEgGY Mxi^44۞QSwvQ_@~qo׏?]?JhwzI_yUc^DQExgGg"ҿ]~W/g"ҿ]~Wdl4SJWQEzG_/' oZ7P?GEWΟoM6 ?7Oŋ~Wd_Q8~EW~N7A:_ൟ򒿈?Kux#/џx#ڿ_]3z(X= 'Ƌ?jv_~h&~ OҘR5-^O?8'"UTKC_5 m?mٯW-q Q^;{Լ=CEִ'Xg{K+5v0E|nit6?<)hfy\1>bG4ҥ5Rϲ<.ovѦM>G4 ?~ټnʀ_+~<U~C~GЛFf>^x;b!GT bYgZb.̺yg(IE޿Gy#~>~/!%Kkȼ9$r$þ@!̿6^y|[KidiUc_ʿMJZjKs4ie9| A_{8/>u9+%|UgsVJ =4}?V~o@(ڏ s}Ҿޯ?acJz-uCQc?䂼+7L5 6āyBWeH[30zЯIQi.}Ɠ}=m դѰȌUEG_mq?c~3JeĉZFE-5>O59zI_55ʔ9n8)c|3I۳Ꟛw_ oxX[/ĞK4;C"><H<ɢ=I3ѧ^g;wANM橧u:ut`VRB 2Z.n8j{vc޿]a+إVyd?<q\%iRזIzj^?uj,GG xAX4a$y#1

|rQu 9tMԑ_%~og[߶ƧmZ=K[ȫ}UcOxY6c(Q̫E5ޟtFyd> Ժo\Oב_WIk_dP^$Mt3)pȻf-oٷvz8Ьc]6񎑭ʝ@o@{9neu|HVe{K%(ۚ&׶;+%݊PKhmѥi\$q"3I+WR|i&Vំaa2]Ji#SBy_|^m[OWų;%Čף[;3qaIow_ 6QcRuJٺO!GX.:}ߥ.k֟=M.KX<lm'ݾZ-(OpJl7t~Wc릋 )ugT7+?= ( ( ( ( ( ( ( ( ( ( ( ( (>K&H'=ˁ8%(߅"`i<g}}3R]MG,N;2M='{$)/ oΟFO9 JDF U'!W tsUl/|?©? @U'.~r__ @U'!W tZ+k!W t*>Tn_ft.60à;V{ɯoO7_o'\V{xPu/55$iml-mREY)v` gsEb kWxKw[m曭i%Žqa~~3!Emu+SF? >ωlPxI>j ]lo?QMZu~WƿD&Inx&{uV(,pX+aEP";%??JCro5_ޓŚw𿍼!jZliZAc݀df~Jk+7oҳ\,NPK_.Ln]׀ ogxɛK/KXsq!*g'/#m_e~c?D/_j :z9տJv:栶|Tמ#CwNߥe3 ?YmU@W ֚o_z?awohZU^$LJQUcy>UݒTbiQE ??~_Uc :h.;C}3[Y"аMUo&T  -< do~|yd\( R?n?d}F?wZٓSM*[)8ܷ ^# $WM6_> 0֩ cm79c6u;{hv_<:i.E2|88+Z7u {^nNI D f" EKbգaORE8fW*E??KKhϵHKbZ((Q?hO(|_W6[/o _^x_Ě/u7֧/ͅq*UF{HqUum-2HWnzMo-gj}|W_jD_Wi^}7|U"!v? A?`6ŭ[Z$^i-t;jhT"̄@ EPHQEQE#=.yi'>4KZf{/ZC9I-%֞ߍ [Y +lOުLs@0K MRUu8e`y  #@π?Q;{TO+#OB\0}A,`$ÝO4qEr4Oh9=%?-hl>]I>VҖ/rxONxxm6}-3@%x9#nᕀ ACh}1t>Sϊs-?Um4}"BsP ⾥AH>8=?_p|~t$yD~s5Olqس~O5о= F\AZ<'+Itq۝jXP)xp?6~Ň.&xj+eA 0l]B>W9[ PI_v۟>pLJ!҅CE{fMq“5.+l:Yx'/WVP.tF22ÕގE1y>_<_6^]jO>њkrwk6&OdZ mV rAzu?T`4w[r֛ⶹj:hZN#P|ۡ+VGSsC7w>Yxs~r$i76;q9+4*g>c5;|ۇD2cml(?τ^&3ZoK-ki׉[w)*J AʿR#*_iRi0ahi!a,Q6A|A,P+Z?i_R-ñMGgv\ȉܓWf_&?|9Z6N9  4jF$g"*+]٣W  ~M'z ⍕KrH W?G_C(קYiQRO,{*.r*I9ߴBP.wlu,z2gB89d ]o FuWXWUW՘I(F:$ +qmf:~>审kbM1u{{P+?/#)~ 4i\~([~Zoz梊($((((#pMgPouoX@tː'ᔐx5/^~4>&Y隴(~ǫߌ FN9'8#5^)Oߌ?Z%Ėq {:0F㳡 ;^^aGI~~&'UNN=ShOG?sE~?oW:M_s3ԹQ޹cɯ,:9uυ.Mޗdڥ-ھb'y5IE<."N.$j5͟qru?\;hϺV#MP)'"噎$.9Ƶ=qq (Z"k)P=i(p4 2Ȩ0DUI'ZGG'ċft/4 }{G )K;O'. լtDxʍ$#p^"r?;2, Qt_ ^~GL?"֣_KOm?C+s^oYϱ_Y=b/7ս_IQEu2qU\S }\=.<];ۆlkpm!\3@qްSݦqT[HI)&5'F$ZvI4V:ʓ^ái_$4IxZۑԣHJu">qُ7xxk"|TW}7 RCRmBF9/!_M?kZ>Mn[,qw%V8=[qzyNkJ-+uV|ZlO JQvWm]/ (?±~#?[VW4um:wuC"Wr53WFd5'ѣɿ3Q IMK{9#KKbUdRp ⼾O$'(2©ԛi#rf¼tqax!MT2y/_4|_mω,׶\W.Dr|9m4͈QWs런|MyON${m.ŝ Wv[1IwVχ;r?_ C ԟ*J2RzJ--D>â+(5^uu],|KEǟѵ/WRO-ݬ\3`69k;#)o3 WM4ݧ#üah/ӋPjSZj)4Ԛz3c)u/kǖ G4cW۟I$e!^i6Vt֚~arn$ J U- [zg[bbhNR%%&VZEsE}vxŹ?9ط'y9x?%-?I?=袊?inM T M~þ%Ћ {:X6ų{ u`WZ i~:\>Nl f2*Z jjO|B\O0uijsSt,ݺ;1AK_od~ QEVᶧ}-E?~{`>%~AOë76mp5ˈբQ|}c԰U7)X]y=+w MCPψItN:V=Q+>M.Db֟<|J~zƷ̶vVї`$+osE>$sAiuWY/YxAԟط љ3Kw/uC(،xXץVwkweT 4j#x--i+ÙMqhR<4zlCU<J1@\Z=RR3|Vg7.i$$H(O'N0C_?Ɵx? vmFIoEG6GkΨT+|ټϰv/ uUO1vnESƊJ JA; WJ:knfҦҿq;!7k:x^ݝ_=ZD>*)GE6 ?J~OxIuӋUwVwLbvy5_SQ:#_< 粯cW] (C󐢊(ol!ԭf( FH@"H QkT~7NWP½>X=5n[[ |0⿨¼ȟ/OOue/-crŸdbTݥv]#%t'lYdKHnYG90Wef'="|+_$=slWd +éF?ES,|TxOI__4qS QzW=GN+⣪g>6l|~uqquB3ܐ+鏂?BM{O|Ɇi5K)a-ϳ2ziNJËgqW7y9+䏍^EjM#MXx->)CfG ' 9޿u~?E I[+]qazϽ^kUaW]~!>2*!M_GQ?qnDOÞ#z]𭽵b8FUG*+KD>NON(dg&u&+/~m|kMOE-^[+-"l_>jCMdmPix*b+s=I3[V׃QEz!_ZI_ڿx_Uo$7i_\jvjUɷ!XW'<דѝJ)A^3[J:SSz+A'?_F .Hu8*;o#)q0SP?&5UgՒZ\!CcE_=~U8?~ĉt]NɿKU"6"sŶN?U+Z)ӓys:?Q(BUw&NjQE{GcJ*~oě?wo(`FHx8:}IkhrMh{{1q8uMuO IG|5m .Eִ<+SB{V^rk.aF97cխ+ {G2<}O%M~q_o7/ssu_,A-xP1퓷>ٯ5;^[Nߋ>> *uOz?;hai\WE^N}JWKo1TEy&zsC EJ\v|5HwM~ M/m:YX,/&n8"i(&S]N+Լ|ga|+W%Ѧ|"i#ǾWП |Ѿς}w r<=Z[a> _|w[|A}2Ca}JŘc[T{}PO; ~\}OV{ Gccni#>dHᔃ><='Ft+OCkeeon( z2ܮ:]-7ďr/U%&ՕRSջZw(#0E~/n`߁(h6m'|ms_tEp$nVn,vO5Q)XG[OpIFoZ%'ѥލj{e+Ծ&>O"xc{to-<_yaq[\9,l{I8KC 63>q/8[}^*֮i=ӱ='9}7e>w$^!AhPw"f'ؠ֮9voY~<Ђ}qO>*j5+ hHftc#4wRjW <뱵 1M!T**'$/*T# ozmR3F;I_5^:YkWG_IGi6rw GpW#~6x{Cx/P+ (R|^ Y2s׭xFPj5~,^4̹i+FO=⾏C~ҿIOi[(ў,; !Kk6c$B~dp4_ &~[05ci_o'w'Q2i~ !uEVT .x3^8ӕ:m8>hJriWQEu8pڻவBϧj9αsDtnGc9 ^~0~,\xWŖdoM7T2$d$<\?8x/wqhv1I@0%EG  |.X$@]7yEnF{+ xu|--mfN-5Heb9BqWg|w<]ᝤ=/#.UIڤmw?rn(ʳX)kW{Iz㑢· 5džEK8ZdgOvwz֗|He2YֵID6V&`'9$ kbuou{_:fmEmAۡ;N?) %ٷ(]څ7?H Al]jrG|SQpWE)zKON?$m[xm5YJ'mc`V3I1zBooC/k|MBky3̆6 _}7ƚ2Mg= ǖYVHd@8k2#F-{W}7>/N:c+xu99yR7蒺ݽ]]>>}8?&7㇎o4};z w}= Ɛ3`^OױaQOJ˴&#@pOUlc31RcfZĺo>^xfImNk@Cvܨn\Zxv}?WkkuG~ ɳ[X OO~GޏC0~YUu+FOi:2=*9SOcϔ\](HQEQEQE1 6eaxgž[s]i7"ݮfɹ[# Tz_zh\hvMC㧕Ii?ˡCrc_9nʌ8 B?B3R-j'AW͵7W:_jxٟyu5%EU.ikaMG[wc*cbbJն۲AEWqEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEWԵK}Kᵷ8tbp+|Ei#C|KEY_X }uauaXPN/OR,?Uz/oZ.keK*H5H?FV#/PWNQ^qkFr)kC((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((( ? qFx|bޥi-։iֶܻ"G;W%K2Y^kR?%|*'h>XE=2 4qEIEiO -Ծ Rox7wWD/%wsƄ$ 2ʱ)W˟>9|Zï۳:N^[i>$M?Qٮc1; vV_ U) [aV2W_O줼D-Nh)'*j~ +? ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( F<׋D*|>%xFEWK.!CojεE9f_/O O✔WK>]/]S;-.W.n69{AyAU8_׿g].5$u#7NtAǰ{ÈPOikjfX5xeø:Jê[woI~/( Veޟ3{M2}G<zxnxnOh菩hl$* #qđn dW_G%>)\(|8g]AE$ ⺍U +VD+q95\#ER'٫[Z&[h~QHQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE&=?lO/xPßmCKu[!{y k)ūςIk[ZYF^{[XR9 2>+߅(TaT`JluJRT6_ )3(nnɶgjܚU6g].5cHbD-nx'( ~떑HQiPǯW4WBwg%fpiGo"|E>2Ыd cađ1A dgJEMc$22CI]2t~L(?Š((((((((((((((((((((((((((((((;OCyxCkPⲵ~ieeQ'ڀ7h&mn5x{Th: q$1gׇkčxvҀ?D(~;{qjC`yj3/Yz_çW<+]-pC`"3n@ (((LSqn.mm}fva' 4cZ`4]?*r}@Wd?vo,q*0m\zœrRE,p_Fp9X =q@y^Q/Q\%ÿ-3[ՠ +(((@iӍ歨vX#71}߳v:z5C)|]IluKR|K2GQI~ ('㿈Z k'4hzryzyzId!{(ba ,eg+~%Uatu$284j((((((()JD̪731P:hW{qk⯎C z}с_>.TCOk{nt 9q@TWχ_^hW>wJkJ;XA= du4JI+ӧ:Pmճr7[Oo ~.ך<:V4ˑ2?PHN~6uDpW/NuKOsǞ8:JS?/a~$x~+UԤ:|*c褚`خuQ^ ?C帼.˴REQZAESu?i7wkFeUTufv (nڲ'er{]{%>b {uOx5c6~~,v;9JV%GW ߳m"i=xY$QZuOip_iV7H$E)Tee$0>ִIN?(`eˌ*ojZŠ()W/⯍ %[.ƍp+V wvU}žW VͼI;ۙ}Rby9[ŠnShr=X|66&($[kTz2BQ*чMR)=Mjz߉຿߇.8uXU8,tiYo{gzz?gV˓RM߹\/:Io 7(?8,Kuo "xoRԮ$V2\}f=;A] tS fS%I;+C(+ )_K ~WR-3-Ggz\袊s U) [aV2W_ϯR­d*!C/t(xL((y_߁7ZG4w)5ޭ,;<1n ~z:ǮkކFs7m,")|-bφԒ+}-MQ|a{}*jE{gOwy>>y6vY1 DҞ2ݣ%~3l$yXj]$kE 4xEPEPEPEPEPMeS ΅g=>K=Bn X{ yγ|!u0`஍rQ^{}m$Eo cs#Dqߴ}2ʹ{y0d6C_boSG7g_<[>zLʭ!ACڻ01\߅>1GǓZ|7Jږ7 뀌zWHj;~1K( (M:>Լo >]v\6zq#K޷?eJ1C[H8{^ޟ/%ǙS)un,Rdt;GPj@r+Dr`)(h՗:_Kӕu4ҵ9()^_M[|B{%,}t/?y,>"ֵeL᬴y_i(AS_y`xc7G 4J}}E|S*ec6x+ 9;Dt]KO~-MJᛷ:ҏ4u- ?SQ\oǣC~%|Mb >!=i8<ȮI^'ե:Rpkt՚QTfQEQMw9Ojuo}P,gwݴN1 ^aWji uF'Vݓ_y,"19[@~jZ ) +?_KgoRc{ux P>+:M^nާf/b찴9vmQ_j^Ʒ.P3́+g_\_(4]ŨiԠj?ݗcu-GTW?1<iF}Ab3Tg+9[V:q5fLZ((Sּ?c]6K=JPs UEw}i%Acs#TLԸs&w<[xM #ߑ@??/VAW4{rg }T֠W&>y).jоkK¿!㫄DWdԱf#G\[VlӵWSߎJZhnixEPOOٿ^rW5Oٿ^rW5׸A]'=m;Jc_N{wXGt}eW2(QEQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@r:x?maǞ"+}#5棨L#%vcQAf8qMOxz:?>0uJ~VhժK_. ɾLJʏO|cFxO|@W|mJI7 8PHxTF+ (j|?V#𞷬xcuIeyCVdg5:7AkuW;m> LEu=<O#w=z~YC+r+_~3_f]CYou 3[ܴv.c 軚1=%֊( 1ڪ2I!UFI5_p^$f+7%,))ʳe p?t//U|Ǐ٠/D μ2s"l+wxG>wJFr64&8zc@Nk4WI( Q3EFl=?b?8ommmy–+>-spcaʌ]b+_+''[E]xOV|˅d&2ѪflW Nη6ws47 B L_oࢿqY10kT "| Z?LtB|g7jimJp|Vs7%şčCAxZ4\4{vFc+ͷ{| /bA~|Y$Z|sZ<1 +vJ0B6o`NEmVmӡ#YYpO shȯo.9|f[߂?|e'윭ψ$Qm$vEo+GY~|!|@oHnF*sw2YPf'UmESƺߌ㑞+ɱg눡'%P)hm# a{/1tz_i[In:.3jNckz(@j|V%1G? ɮxbiz} }_ğCxNᯈ&U;wepqʼ2D,!5=m "7⧇1}g-Lw6+{PKGEQEQEQEQE 8 x{_?gXl'ޣG#'Δ|s7؋V =ݼSCe'yU=ata~_Tώr~$AoIxzSeE4d$.&{@qN B3Fhc (4_Oi36]Em{sö$VlW{ ,<3\ ؊i9moަcnj ?3Ut{{;Ȗh. Iʺe V+q/GKWk&[Ojw|s˜BDX| (kR?%|(_ )(cOAQ<( DYا(v' DYا(vnQE ( ( ( (u4>ki\$q"3Ib۲q}}uoegiyG(K3M~k~__{ W-cmObڄM0 J{I ~rR5O }ŏ .S";$ Jz >͒T/*0+ټ(h~)GGoUOweEj|oGR׊5]#o ClyUqǁ( 4RI%薁1Q*}Ezod|J5T,ԴE}!M{יU8sb`i4L?^  @~5"iN29?u;GUh+No>(=:Z,|9ɺMJ$kYQAec"y^~-\_ux:22t#*(U(? Y<-sX4M'O#ssl8>;:ͪmJ#-K?Z9CVZ'+v8 4xWIcPʥ1$%K'??']zōN&fP B +_Yl1x@Fy>ֿlXU $WTo+vfkP6][U]phnn0A2z\|-ޗ>2bAUÑ:WO؏|Ko4xwQe ,vl/ч#r _[os^ګj&z Ȇ؎ H,vϝO NOC.jU/(̤unM[[ x?A|BE%Ipnd^LN3 J~׿?k}Ǟ$iἭ> ?[My4<3$]س;Iy9i\AI#$㯉^2mюIX7:NFI W??m߉66IIU!zB2={xlP¨ewo%~ U8f(9I-dUz_u3xޏ~O%]f}ZE$@c;~ne ̓3%Vwl'ԒiqEy5N;,!e4>P]mݿ_c4QEd{d%]Њ%Ko,bǞ m7;e9)|EiN˚s\Pxlu58>{;r|!U/wEԴDa\MTs9$O}__aռOVtR' 09/7/.Wm#пoo+b48i&ȑܼAo@7RL~/֗70'vi+(((?i> a_ju;v{]>5c"vơ@ORImbQqJG=em`ӡ)F)$/ H>hbo Kz?hx6&jZLJ2PaiΞC$E+~q_^J+-X[~'PWNSI|vgQ_l~)y8x?egկ🇴!í0v  e~p#.v^.x_?]V*gn4>h+;6ge c5 5.0FGQRQ_*X]H'>5x'J{=Ěiee%Huld2q~ȯk 'ƋOK_M%TaօHO~EW~" > ~*ռ1]h }k!%D6r98# (׿+\yMmUpt$Bo{[]]\1ygǩfl>>(?4{;AiMj Y 3ުC)%s%~$R֮-&Kt`#$$|k(wo_q^F?ŒMFKUI>qj}M_ (x쇠BI#uk9d2 0[v<65_t?`XjZIYo2ռF5\Q~X43%\BNN+_G X+ @$ifE:6ށCWßܷd%Džxu.KmNnk{OȄ2pk %QOkz_ɢ02s#UY+ ivHCc;;)qe )/ex6I mdVY^h?ϡ6Ÿ$h TQ‚3E N[:hzpdB}3_{~^|2Ѿ-[ODukX=V}a'u+'EmGRyynoK=%L1xkπ4?Z״Qw[T*px*0<+ xjYU57qO: xYrm<_>>)#J&}yes T<8#~=b#gGop5~$=e5Q^!_q_LxkV? ꯦ̶2^FHX#p;yS_U !S':v?i|G$&1(袛%}cnAAMAWȟWgg[~(~5K]3Icc=4ۘesJ$('q= x=/U{%޵|tȇwq`2>76cQ7 &sSO.˳;I/>i>[Hd@YNUA).!hw_|QxZ÷3IR%$V\rc'd _iF5R??.a<Ϥkw](#S&ڣߋ?i/kP֝u+\[iX,p~XWdkHS} 03ZjO܏MChSlegU~{ >)azꂦxg7Cx*{R|?j:t7 ps[$Lĕ;AA2s_nWO/bҕת MŚq-eJ*)7em\U߫QEzOOٿ^rW5Oٿ^rW5׸A]'=m;Jc_N{wXGt}eW2(QEQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@EyH鿱v?w:ĨɄ$~Rۏlg L<'DAOSs6-e9M~@׎o>9ּM\++'͞g29'ehE}%oT/Ky]\h^%bH^3HH=P͸o1lwOjlXl{Y N < hAm]kŸ O l.nNb18C_'_/~߆txEoi;@Ư5OY^h_~!CnB73HI $-|gό>~9𯈼ڜI:|W,S0ʑ 5?Ii7>(xGL>,ɶOv.'d~6W|j.LZâh1ʛ>PpNOM |[Su|(>.|5bH9>] @4C7~O~/cAλ+S6zml-#uR7.&4zECj0iuԩm49Ɗ2O ?**u?<5*Z&so&ٴm /$#b<n#P~+?5qB?x2ԓ/-3j6?==㫼~X$ rHf$E(]HwҀ?%`czZzZ/쥫G^4[xC@-;3G܂cԓp!h(+?U_ $|QB=Fe?+xR^7S$ZijC'iU 6;Մ洔, >JS:kI k> ֓h4[Wux"X?a#bJő1VC#+TT}Α[gyg3[̻d̬#گ3~(|Q'}pL׭#?;-Ž,&ُS}YMKm VGo?Q@Q@Q@Q@ _S6r~÷ C>#&Dr޼9wcKk˙&kvYs$;3bI$I$_}\ߵoz-MោIi񬛣71Hh/?-O)O;VY;n"KGe c 4G\26P3?oOď)~5A|'FWͿJll3 9V u~ ׼mtoּCv~[g@ǥ~xwö>ifvᶉ*F8UU8US v> [~ ׼rܥ֍n.^e#~C\/_N/ _|@'oVxN#\Œ qTs_5SeKԭmJK[kEsWUA@\K_OaajT袊 ?JOK5z򎿧jbOK5z򎿧jEP (((=+ nKO[|(]xH_kŧB[9s);Enz%}2[X=b1_Ea5[zC#n6췇?_w]kּ-9M7^ X RɊ\ $08 x9cxҼAh~7}Tvȯ]KxGY Bm:!dxخ0<|e߅Gs< :X*{hҷG}$5 ^u/xM45m;+k4l Th42QRN2WLc?6+?-d-ħ=&9Ċ"F0or\hM-&Z|g sn@ݏ]֡{rEU0S$;zS I޺>;z×>OK?U-EcPʥ?9nQA8A| o]U|#yx>[z;G /boO᭼0c),m a-__ <7g6t];@ZB"pN9f8c}kes3~4[Vx,$=ekho[mC`WɨxᏎ4>%}&Y-_W*0 5t'å^i2+xO$7P;b]B[lfO*Pw0C2CT7h-zt?,(4W~'zP6(4fk&V7=6K$`{ i$LV==|u$zNxV?eo@>kڀ<ﺾasJ~gcמNK{G񯉘_Uk_Sukmu-wB'FS]P@'p&'HHe:d#~D+_WSRot]?^]qa?"E%b9G?0`v+n| V.8lΊ;)Ż&Ov@ VVVRAR0T^Js;K=>NZ;SC*p?W}aG x>Ik-GH rd@=Ȯ̾|_Ylq;ֱ&gsE"8W$w.IgBE×M^nm/揽J|'4QE|id:QZ>Śn\jƯpvKXUGJ1r[4Qɯ_G|ja ~RPXZ̧Mr1O'7?e⟉V Lk")ȖaR(tm5arY<]? o<>OMTr+Jͯ;$֧_ 5KshjPdʪՈj8͏,Iռ |a{çkZ2=tHŨ. ,`| :'_q;R[s \pY8sv~[Mwze8hSK^)WTKιW{K#mtَ c!wSJC ' i<N '+p6}q(ـWlsBd5ނQ_p~]?"?IaE&^}(VOK}Q_.RA*! *&JUBULWd?ß/#znQEKmzos5W\60}2ю_w6:";tV=SZږ\̬YI`;jw|3Ν;Q_"U&)O~xWؗR":|m /:zWA8oٿ^L|w4hGz0]eeDY mb+ӡJUF)$z71id:n %690FM~MuC;?y-1f86}]SLJg//cvoh9sդcNK3I$X8xL#z?L1I`j:4ST]yIkw;-"[62K7[y_ܿB| >jW43]3?-yrT~Pkz^lgNKNU"Uc3nIwk3rV8?=Tǭ趫kᯈKEjfH|w_!ZӖsj9?W{4Ӻ~_oq7k_ƚcGAi\k@3)TvYp0+N O߷chDѯp 9k|!ѯ?Ǚ3l+>Rުg1E |>;[ǐ&ĚnCٍH?v"geEPK18s?n/:ow}>c/M7w5N$wS^i}cNRk~sn\(?8 |Eֺ4=SZ6Z}M3l*I dԿ ~k_>$h5]Dw1y(1w=C^8r2ciMu wbcfQ-#(>6F4PhqZAEW/O|=ys?XeYO r Wtڛ|uvd6gp>Y?8as_ͭ~?ǟ &14n\۟s)_'8Voi~g2pqJ`yAIٯW*(S ( ( ( (?JG=e֧z?%s/D!|Cz(r!ؽWf_S ۿx{0C߀K?gKKF][sVh\/_ GU><','+KIC&߳mfFG"[;L Y1G]FH(#ihOWq~Y g^6WF ???b?xIK/ؘ?]9^_}FUs#2SNEf8O8h~(ُCY@ˏ?Dxzh m֭%Z:}d!VS:ܼfdlVr}ʹ>Yl"3_jkm9]XPWԟFG:. s4q YӦ5s~6e٫ UX|5b<ϹX(QvG^#:eZoniG~xZgڴw1b}ʯ$t.W~:P׼ckƾd,OB—_?WZ]->*P^!bԋh"K`/<׻C#z!NPSSm_*.ͻHd~ /7]g;~׼3~FoKg#P(${+9? О猴; {IByh8F)Wo1h !ػ~W/' ؿk꾻%v)J (c' '/Y9+[ '/Y9+LgYO` Wsc61]'=m;Jc#>2t~L(?Š((((((((((((((((((((((((((((*r|<p~%x K vY}ْ{;~Ab,tGX## e(G|Gj`1EPXw D~:ī5O|a<\Km#Z2M8# +sI<ћ7 Wo?%GX|9 ./KXd$ܚ 4QEQ@(#4Q@8/_'|ti49S y3MƷ,S /3α-N#j(B(=?gMmđ4g&mݝw: "dZ+|I}K%Դ-buϓs uaW)k;OVߏ\pyx]Yأf rOzTO袊 ?@|%x2gIԼ;x Zb_{h*GJ6~*' ]#TܱvK 4:PLߋIQ`W;wI??w^O/bMXPh?? OkF|M2GVY Oy(LUe0L]R2_ Wj3_[|-5o i6ck:UZF#$PE(7g_ :O>◷< la6:yB}ɯ_ң>3IUA(_+?*?J$ 9PE((((+>/Z|k,^sGe[x]l$Wc_qqo3[jZ\:\N"(~(\~4k^"5y6yM=ĦB P&P٢'?#.DO:h'%dW|D'\4e?7W?Mfj g }VFB[Ki4ܐ:9m\esBLuVGЊn``ъ(3 5򒏏_>jTWH|zWҧEPQUYS?u;WYS?u;PD (Q@Q@Q@4]~,{ݼ omq_ ~ž0:o]k%3:hඔxcN3_!T[_^ U9?WPN֏O#¸?< ˺/\340\SU~1x? CO[? M%.-w5F=s jt tKxcʾ3&NR^vmۯc֊{D?qGDo'>ˊk Ǖ8Fk w| 4q6Zq4A{Do'>ˊ#O>24]?COO=$eP 'w^ni^=>\Xti.ҋkDExgB?zE&P[n r濟$oc.Qy2++2)7FKGc E%rWN)H}^џ)~g3cPʥT-¾O~67[|W-[.9 DtTV~c: U̾j# I<@bqxIr*)>ӌ[^vnϣFK?hֺ~koeacoo8 VQ_nM)6?gz߇VO,'b$r~lQJQMYN%85Sx+zqqa)=KE#FO榨ף~~BF%~5B^I^~ɺDiKZQ8-ki_Dɚ(4hkW|38-k%L']@ʸ,BAoƙbo$د:Wь]ש9' З*&mJo~msԇJ(V F[{dhu#zo~Wh?^7GU|EW˟ԇ_JH_ }_򐿅o%AU9އ{ۤfhO'Cxτ2ǿN|#Xn?7?]hȯǿN|#F=s k 8?q?d/ yB`x'E t~7q]_l罷7VwI*- 7=+s_?VjΥ=? \~S,`8M$]Ho'ӿmdhnȖ:@47ҸO?O0t?[oDn{Úٯ+n)?3I< ы9,a?k+ 2n ? **56\+VɾҟI`p-ۗY"EQQ=+Ohte8$L R6?2?*mW:͈^ UX''Q_Ey'<_4o/Dҝ3/pya9ֵ]> ?+MĞ 6M>[I]^!\Ul0Q]] ҦQRM=h֝*MQi٭S?n'mB&P&hhOe#uT//ß(Oŝ>5wl;=׭x=~8Iq_1B6HOI.Kf)󣅿5zVoSVCL3tUF|#>3?,VY? ,袊 ( ( ( (?JG=e֧z?%s/D!|Cz(r!ؽWf_S?< }W7}%2( Lr>9WOSIa&6lq+kV|p?nSL!^8_.yjOO,@8Z̖5G_',{^$ߨP9Ǟ>T7P_kߺYk+W/Gß;jzAn6G$ޕ٘VxyK|y䜿z_zVp!TtP:+ '|_ _+oegi| 4p1ia>{m5ԋ1HBܒ@IH?gO Q[\6ӕ`E~EF=s "7e}7OcZ++"7eG.(wp!o?}C4~(#i9Y$rQY,=+Wߵş=k:;Fv3+OcC狴M%Ե4Dvگ4,h 0@OOÿM=b&}WBpsT^b73Q)|0HkO")T{[s,N8|9Z$կ䷷}z+b(?¿>τ#3%W3(?¿t?ڼs>VCQ__@~`(II^L~Lƨ)p[V/%O(- TҼ+:gt2\%H}Ḥ+TP(_ )(cO_ETIGǯ5*z QE_j'=SG_ӵ1?j'=SG_ӵKp(QEQEQE{%\ȺgC~+-c~V7tjBVЁ)־+4{GG?K90њ?Do1>?xšn1/b;;U28 8` yҴmoZ{U3ƗT[i>wKIXEC6 H*+?6OAtd?#z:C6 H/H&aa{ 6OAtd?#z+t!D[$S?}XH 5??W12Wx_2I(ͷPd+ '?e?M4xQk]/J\.q$>VeT5I]_g?eiGlv}R{h-rWN)H}^џ)~g3cPʥT-¿O?گ pеZï6C?뇇-V ?ɟ$/Ӱ?T(C(nl;o3_7H&޿)$~LExٿ7{ɝ/_Ot oM5g W+ȿ/O"/zQ_P3-~6|3(>v:+K7֣>iud*?X;E|>a?SOT /JP(qrC_M/` ,^K/ Uoߍ{xŴGr}^'Lc}Ov? **j#'?gOJa_WOHXkடooח >?R7GU|EW˟ԇ_JH_ }_򐿅o%AU9އ{ۤQl?aoB[ɴ'j |Wݾ2cW? R?OJZ3(#7};~x>hG wpJȄ)y+$>`OݰsyQҾ[ePqj[ZS ((#"( kC",r?dd¾PڪjR?"m͌:u矰|_<6upzk"_}SV›->+VXؤVEXv?hktH~>"n:zsXk%'Q_QEQEQEQEGsW?9.H8+0o"o}~ 7sQ⽌hoR&}MEWֿ?+?^:˵ַ. nH㹎Diت/ U?|Cuk V>|Q!OŞ/cޕq~#1YG WYkw^&֯5+i/5)亝i$bs&FS| y8KH'w$PzWGH_o_Gq>ON8ͩ n=90wUjN__n2sۏ_g!&e29C_Á_[Qֿ?|^>ʄ_E(/]+54ٟa w Ewt2K m&3^#RYoRڮXǢRTv?uʤ?QEzK7CqE·'GTkշ 9!sșLq8znyEnKս?KIXEC6 H=_s<'_2G:_M(KIXE¯򿹇͓]/H܌_Dåi$ ,?"t!D[$Q*+?䏝'G:_M+?f!O:ǚ= 7pJCa2 00ZvZ8IߒGLHz|'aBlzfq+xOKu4{Xa8* ԯO`$lxؤ9Km_pvb5:8oO@Nyx5%CZ(D;ONG_}6?-LiSo'g+BU2~$ʾ򌟉?wlg#?GKK;EW!_@o0(du_@o0(dud+џx$ď#(L7ag#a D_nWG/bҕתr>!ػ~Wd6 %5_IAEW~b~$|/%|S_k|/%|S_ x?8I{~sfӿ:ͧLuwGf_/ɟ҅Q_QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW|=+~Ϩh7WCIz@u1}o~~7ßDR.qmg~ݘm5Q@9+}?J?\pd𽾛zIu'uI||Z~0|A,7Mu'<&тzU(A2?t(--Q(K>5>/$kM1:%ٵMfA` ^#ac'%AWXZ𞏭xkTV4o,>jDxp0Qjþc {A|m1ͥyTu_GqD"~2ivqh:\~'TB:x%3 zPVhnϥ:@5;|?4_ M2ej1R/#k4cx6z3 Vb@I᥉LY1P&HQh( 1~2xOf|MB}>PA5LapGhcg=OOkVŖxwѫ;35n$ij@8J(?/ݡWhMB}~FPpIwuQrZ_3/0^C ƑoM6B-܂Q[ۏnd]O藮ߋIQ`l_:@2Go[|-5C2Go[|-5-J((x?'x?'4 دOOӥyz_W'gڀ?Z(0(((K#Xmi}MW$nv?n?}\Ib?'j)Y|e]"'G纳?٢qiR[i{foqc Ptu<+<1M+\Hm%։>k:~wrM)i";뫮S I޲9z3OK?U-EcPʥ?9nyop~_\<=je?pLO%qEWƁEPwc|LG5yzG'm3k?:?䂾U=} o/(U=rJ( (? ๟'Mq_!ן\Hω8_ǟn  CIA^?cvּ{ ';GeO^Ȼ , |.W5~l_HrIͿ%O#f(?q } G ߱0?K;8fB?Te*}.TDv9Wq0[٫Ø*LիYۻ[۪QLu5d!Հ!zO? FJNyiHhwOk2Glv-Ӿp71IQB.R\-\MhaiI۲G_>&A%mU|y |WWC~*5Zjܷדi,]p; _V^ *o/y^tZ q4A.Onf*j`Wg'k_|:2MD0-tT!RU&Kva_WOHXkடoo׋ >?d7GU|EW˟ԇ_JH_ }_򐿅o%AU9އ{ۤҞ2OxwP@/%#Rmǚ.=pO66RWmK|'o?WcֻwenvecИ{0&=Z3^Ƶ7x& <n݌qȠw_˟^ks|KʶC*iKҒ[($x~&'aVn .iQZP6jQ-F_YqJ%Wxl.,x!&ھ}/W (3󰢊 wX[~?GRQ6ſlu*{7HHzups2]<^sj+-ߑi|O?}3H&|IyIȖ9L07qlי(=}O-|ۻ?xaCOQ^Y~A^ ,#]XϷZw>?~?x|-&~_]:2$0#V:nx>s(r,V"_( ( ( ( (?JG=e֧z?%s/D!|Cz(r!ؽWf_S o¿*]of/!f2 f:/¾8^&_y[όK) e}CQ^p~Orq^k㾢3_H=8?s*<̪dմn>vp=xCSK^$,]H]ɲ8PzIHI,koF[Cu?ft4;Z~kzy:/;rX'6B]7x_88J'Ӻ}/H9D .6W~?K+__o/"gQE}aGwu *15o%7R?"j*2qjQτ_7wo j6ru qko=;;w6lcs_b(*ݜ1)oKI}L+"OSfM5|Ea?[rg4QSFQMtw:s̮9_[?yF֏/39ʗxdLbh[t#}mi+Khz'&LZ$n;WǕ՘Uk-_/'xg,)S9r*SxෆKb$i]@$I} t.h|7~#*̾X9(-އf<6N.Oow./٣_?cx{IO52A<۫ҩ斾T"GN/S^xron u;7h6ۑ1֥M]Xq.Ln4AY4^Uz ~ڟ|=0unc0ω? y~{(@080qR^'~/O CEWԴ8.B~l7$:?_fx?:3Ntbg8Hm.0+lFk|ENfLx,aⰔ(wy/V?+*;wl((((+w?Cӆ_U h!S':vo_|+EWȟ{)0HkOSac~_I?6 4QE}(Wʿ[?FOğ;WUQ'#NU͌w_}_q?hC+ & &Lz3o?}EWɃfTC_?tֿ!qZ7?5\֯*??͢+K b_R_nWG/bҕת䦫((Oğ/ؽe䯊ko/ؽe䯊k1g=q_N{w\wß) үe3P+# ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ?^cO u?hWV0[]a$Rt6ڗ|QhzդƋu-淞')"*~_K믁'bψ mT~]#X@Gt99Ĩ Ȑh4>Kz/|'h>&_imd H k?to+Zo8+k ڍʕhcd[;Il(n'"Guxzմ2IeA:,kRi3ig4֌$"OO"yOGqxg|;ckI/uxi|(wYua>)ՠ{]5̱ІdW:}Η2͌yw6>6@r Ex'5/xWaIAb>Q/ƀ(猒OF~5hmxJ᷼t ֿ ?Eni奿=?q4 DO_-|M^ЭŖ\D+$nYH W(4앨~Gȱ_T=:GRh A?_%53fǁt? GgFg--n`;,j#2 ;h5cFo|5YjZmƟichmZvVE; (Im|!lck^%o-u +Ŵ,R= `7]oO|4j>_n('|x\;!u}\k$KfH =^RW(ǏzT:ƏzRAu{Ն dEy%̺Mqq1̓JI$?14) o*_/|P:g/o< 4`n UT|E{ib)'8w< w$M6[$Dߴ=?[{V[mdG`@?a>?5^D5 <싿+J(3 ~.'GnKE\$(MzV)ؿՊu_eߴx[Fk5_eߴx[Fk4 [QEQ@ )}~O )}~Oh_?KjJدOOӥjQEaEPEPEPE߱߱ mj;G(cٮy,|=_g G?}[]6XSX)l*Xoq 42*de<)y CkK0>xJqzW[Y`"0hg~~ Ҽ[V~|`E^ȶWXp&ԑ @Hbvo^I  _Ʋ.Cz F7]>o'<[܉"m4V|?:~%E?XfZ`MSYCp+/ hA$Gfќ lO4)`I2;(%_:_V9{gº} Ķsj2+mn$<8/OO[a'zqTjw1gcIhSo,lY, "-c| _WbMٝʳL1~&࢖?SHo;Gt7w߫FȻ`$ωoˢ QETIGǯ5*z+J>=STO((*Q?,):Q?,):"[Q@((( bƞԴ}JiWQkQV"/ྦྷ:|pWuuocQ@2DQdz"68?<3ff<;l-K KOuNHs3:¹U#/42XC+&M|?}3E"ikOӰğ?z֍!d7Gq <2/#AB9ܿ؇ }՜Vڕ|h%燵 ; -'ʧ4[̒FY#}v0>8 UXFi]۳]W]] ` 96Cknb5bQ*\,liH) y?y1^sVV4~+;8sZw+[OqyqoioޖihRp+V?vzHFVM~. *E# s\>TO>؋g^|׉WT_gdR񥮹A/0PhO޾0Oqlj 1,$LF8̀35E¨P:1Nkϭf|??iwi|mK>/~5p:F BE ~?I'g5}V(Iu0rRirWN)H}N|?/flTyC*@WU!_uyopס3?۟vQ_hQ@'m3k?sW? c'.^QW'OͿ\Т=Wx%NC?/D/%zOwZ'O?zu"G'.++gBE×M_!"]a˿&76tGa%>_Dɚ(4 k& AN>rhIok}O~ V70RѓyЏ -~)mңO _G"[kkfPE9[ioEok浨ǓugM>SWxMѩ-[N-q}}7u|;)鳭H$aGr5ݾY414&>pG~T,7G ĻUUG:U^;8G<"VIJ֏RپڅQ^y(W:o~,yK3mA'z|uϏx?T/%]GeemM,@O?b?Nf ˖>t{{'4;W=tLW{G_O?'{#}- ?]袊,+ )_K ~WR-3-Ggz\袊s U) [aV2W_ϯR­d*!C/t(xLog >GKH@sfNP>}+:n;N?f{7ot67d'-c85zjnܽ崣 p~ gJZ438*+]\~K~G]KEyg AxGLwT^ƶ_O-@a#|e a+k]n;{KH$E 8#_w_ ?ixr>:"JF+gJ~?O8.>yeEJRwqjumc~kHT攚? ;Q~ӠG@ ?Rioċ mǷwnѷ> ~yokJ ~n^i[>Y7 ԼE" O[oZ Bu#Q coA/n![fec 9 ~S~(zfYqmdpyzGü,𔚩Vr~NT.%Q_T3YèoqsA:4rFrw~߳IxQ޹ݳ7;* S_3_r`돎 -'xVͮqu){H˩|O 5x\C:Fe%woD~8PyH"Lks-34\[WԂr GB+ įiCZDk'f`4pF'*Fv3HTϯtqU(O9UX ӎnOG_xO^RkyDeՌOUGM %F:poxCo|D JO\::V}T&=/k~'7IW"xz^%ROm=RJ~^ʨE~"~?n?. '''Ҿw;T *̧VҝIS<)fXY`愷_OtF#K+?Yե:}'h x&Y9d~6Օsu~`q `u;t x?JGWJ~UO 5pxͨޖ~g~ݿQ~'d=>_3NJiqD2vbONԩ)˚nk/˰6_ _3^B] d;mydEͱ}"y8|0DQLN6>E7~ʞjϤq0ZL3dv['_cV_m'FUQE}qQE~Kl/oVA֭5rWF=̑N1 <~mWG_^nD!w5L?p;3_Oe&x~nba>7\:_#]:m/ϯ41WuGy7Yw9F@ih$t6UdcKgzC4xFT(IpW GKIP+  ͬ4R2_ ?</xgwގHf;H"q:Q_?̫T3-^ jw]?riI= 9JhhT]hZ| O&h?imPv4A0kݣ/35+՚ߌ_O^6d/'%%M~B~3|UXu3ۮ@x^Ws4mq?[T?hGn"!_ᯄO\.@Ե6ͱx)i^bɯTWPo?oO~O 63Z[̙P亲S1~H?ktmBY?c̱1RÌ-E\-' SrnWMoZY$geQ_T0~.}vp>;8ju_4~Khe?:7[ I~t ?o?2Oް悊(? W g({*U2~$ʹ `/.'Q_t~Qq]~QqשF~MG?(0lk.?kW7ag#a yOОXQE|~_q]JV^ b_R_]|%Q^oM}oM|&3~_'?Wy+|9NҘ냮Wsc61AU &JQE~EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP1׆h_z|ek%j6+9opC  A" wXOZ鿱G {MI[;?ʫ@P2mȿf:_3}m5+5L0R:(q?o4B_L~W eojQc"eI5\97Y~ΚsPf6C <6"Uϡ@h.Wc'={4Y $H/=yoyxXvׯ}\XӦvo eQONϏ `@ɕ_p~i#2ԿږuKxX&&O^h q̑Ư$0DDRz$Aֿ5 O؟g> F>)iOӭz*޿?@N=sJ|q G6\\ۿ2~~:z{?<1i.rZ2NcRT LNYXme# 5aD/}j,u(H.'}$ Q&3E'5PwJo_Wⶋf-n?o1(=WW?/hf> *+7IU%ZOG.bR*H ʣ5x?Xek/+NG W->9mX<'w^͍nHy.iW(?{ŽNJ|7Hk<ຼ zw'aAZ\|ZX ;IlW1:eqs_4Gag5vĜ46ik00%M4_ |7*CiB!BGh*hnԴQE ~.'GnKEUm.\Үno"h&729Ҁ?XՊu~~iz7ď ˝>VԗMRܷ.#,~`ϖ? 팧IL<sk#-^>њ|s6c-t5 ׾"Ò@ׯ'xƞ"EP"Cg[Z !k"v3@EPHQEo؁WK?p7SO'oh6>,֔-敬3l%yxP%WWP+ODO=>-|Cg"]㯽>/+?-۟iUU»mv(2j4_8}sݮ.gm*jbjdD?+v!E"@QEQEQEQEW ޸u}W_>?R)dxfܜ*^`|,ޡo؊J|O}S&4]oM*vm%BU6Gj?o#)&$)y>M4ig"]e d8/Y>^^|">$i9 ?T?)$Ǹ9\/>BiӴᓜe dO[K 8MO~*X`$8 9ո|?\]oqkΉmdgp\er9:VxƏư~qyq@h~jύ76s. dʾП Okb8ppK {W ~:/:W_ y#r!EݑORjOأ ?dJ[׬u~)+"k%;V,2<5R->+{xPGqT@UPKdQET(cO_A+g {_/ I֦uq/3*)#/ ]Xo+Wmk;G mɯY2*]+ 5{ 0$g}LjlAuPU D9Yا(v O'ǫ_E|_77zY\eί>0 yrfLx)G'$U]ĵ?(7>5|3i|5&:<{9tWoGsc^M_]J P]4?ةqܟwW)H}]]S4[oz}"2HFU 2 QR.Pq]L*odX(_R۟_>wU/h9)xwMpdR`2z~ӻ六iAD=,e;>Ii>i~_\<=jOWn_X.pdmEğW_[ ͫ elju}?R'%7nk{(mR` Kg=^Fn.ɟe~ ">DddkD>+O0 7Ac5j|G>/~&û\|O}.qu;twb?{3lnMBܩpu&_팏:N8i5)(WM6=} o/(ҿ_fzEa^~N]G*e8_Ft];w˩ŦZ]}t Ȉmf9$ۏpʆ߱dtA $%&M$m]ՌH+ |.W5~l_HrIͿ%O#f(?#b=+ڋ y_~+Fx?_Ь ^$]ZB9{vbp| ~SS} G_d u|3DI#¶˹Xd2$q%On,dI9(5}髧e}}~?BO |fԯGPRj?T;珨tS{_.=^%Ӯ)pV;,]>6<Wgג[#f7ULWG.%ᶒ{]*W2)w\"'kF_MQNծCf灨(A&֪vOg[h-Q^@# ]aj?UZ]H<}r%`:$߲'aZ\bKqUwo!=KxF4sMsŝ^\}GfS2 AJisnWЭ 9)'8ݯh73|/񕞽c[e<H|NQZ=G cT}`%޵s4W|Ll|uI4|3,Őn4-0''׼ H״#Nݗ!bFQOӰl5XvIM4ReDRA+.N=qI Dz~_m©G\#>~?$ȫ.񬠞ZM{E_f+߾~8x\o 6հXޛGaذޞ<,wd%|N*MɷPӼ#7VCk6N3 ePFq_77յڄ'"e~؂`}CA!z>:NUps5e]HTUjn"x9|9)ۚmr&z[4#aZ( k4oR{Ik:YͪKhćD9~hR:Iea#_1ؿIυ?j|u[wFҿ7pydϞGӔVIy}wZL;~2|2·/ѽPHH7־fcG|7;dM4k}՗=Mqh-⌣,&Nd%GQV.>VE+,>k/ɂylfߞ9+\qٗGęcM2|ӄxty? +OƛO6te [=mNJB->aY^.XD!nJ%#mvٿN$7kM^4X8A[c7~ f]c]Y#xٖDՠXthe#41,*"EU@P; y,͈xS!NGQ[zV̿Ge3m5ZY[@rNIkQE}b?RSշaES$((((as#ֹa+Z9\z˯Q r!ؽW}~q_^J+/y$3 Ң~QEPPEP'k y&Kk?ܵƩdh71.@mbH=ȯ ZѭX?_JqW߷V?xũ,MxSzJoIIv)=TH_x=~K/~ MZDuu\] KY*9 #mr$p YTnWm8ȿak*^ qK<S8&%M4{>ho"m;/h_ džtݜ+:JmB ~ƿ~ɿGRx~Хڡn'YYTB 2l=XsZV|bL+ƤQjVJ2ZtkMO+(5k[öǺb4kϹ~k࡟z|_\bLnѵO+[Y r/A;p| QT}LJ|GO%Ω⫻SqI&ߚ+o ?h _xzihG""ÏxFVVt-=_V?Qfs(R:jO;&b-`Xa{*?ƽ+]-ө^)e쾦W^~ͫ$M=[vi٢+簯8oO@N~WW/%Wm?<ik:hZ^ EM ʆ@U`^nmJu0?D6ekf+mkfxao-_C;_TҪ¼w2څQ;WnW3q^J. I)|0HkOȿؓkCD?|@|7xgU ^, fEVbkW*SկmocUT䌮㪻j= EW~6Q'#NUUy8~?]^H]d_FkH,6~]jwݔ_ qfItd7+N#J|Kcx'8xg|9sPR{8.F5 ܫ-–g)M X*+HcUQ1KE(`QEQEQEQEQEQEQEQEQEQEQEQEQE!"]a˿&j|.WK|0 /"GQ_gS} G'JpTC_G&w}?Iҽ̋Q_/'BNg!:t,0{@>DDuqRQEŠ(AEPEPEPEPEPEPEPEPcIm}PjJ(\69<9pS8NR8TR3ӇQLAEPEPEPEPy!k\ₑ4 CL ⧢*+D1 P0ihHQEQEQEQEQEQAo /z,2,O{\,01®OsS)$)RYtӔ%vߒ:J#}kVA:eNŶ 19Ҽ+i◁ejg־%^|?_z~$m- F? _n?װQFʺe"?W]|T*<1?g5Q_hQ@Q@ NalaݑmDuqRb)(((((((((((((YΪ.jJ(\69<pS㴊/kP*J(sKE((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+gBE×M_!"]a˿&76tGa%>_Dɚ(47b?3+NM؏L{?_OQ+p(((((((((((((((((((((((((=+KEնoCIl/5 -q2ɯ_r^x,MŞn/ 937e/񌸧 s?2 NvNE8Ef#B''[ 8M,ƞ %d}b~n?>%XRf"}.;E=abpgeE}Kjm񣊩b' +>iֲM1hP((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((ଟr t ^Yx,s7ј䈰A1TV5Ƭ9K(qn2; 8;Y5?/+hO47 Av- l}q\VOM'h \gГf+y :MS4QF⦵ W620YuXP[bv#  >xoֳ=ſt}69\aƩ=뢢y}<;n7m>0Hc]}[mQEwQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE|U~{}P|U;.ȷI,9ݶ2IkэX:sٞSbr\1Gi=Y4~G Y@6;֡$>M-bOxg#|[q}Exavo?`fjh79/%hOWH&'>c&Dku8J+z95;< MѤF/~D&^)-]?OCb8E \ғnp)QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEPM(((((((((((( Q@4QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEPN(((((((()7PEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEU}OU4.-m,#%Y@<&,F/$F 7$\ \eᯊiz6eirIe)m*) O*9?׾5?>4حef?(Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@P>YQ/[O΄ygS۸U5'^_ګ-֥|`lbc|3/EPcč]5g?KI%?<+kQg=q'p= 1pxF㟎<평.I|={mJn,D]*28ՈɎ_ + ST| 4=D[No:Gqr߂G9_tIqoSV&;RN2B.{ds?beg>%;]qF0:v~O?|/~*np6bC6A|' 3??cm6eqטg|y~f??-~x3:g?> /`Դ]rBռ$E=Ցkӏ AI5c56^`>q_=ɉR8eVB1`6濢9 (Q@Q@Q@Q@Q@'-HGE?<Կ|/kSu}:HFB"(,UUGRGA?8gqZ1xgO.VҬ%I*[I._-B2G]ٯߵG ͭhm4H󯼋h$TE1? (LWInw8mI#icXP93hfVwjA$sA2 #6 ) 9Tx'᷇[['MG# ^A!EPw`O<]'K7k[4ajF^I 8Ub?vPM?S\-񦳳H4 ~JwbV5HU`y,fl7VIº;%h[zq/K A>i0' 4E=5l~k<74 E +uUC WC @M⏁_<#o_@vEox]R떑ghbUw|w'(B(((((((_ί J||Ls/z<bKe,flodiHݜ6pG_調9Ss4/Gt ٟ?m'%III[G #)©a4oQwWEQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@#qik-o-u'.1xMПGG$77̶*GTvग_Q۟Zuu9f|%9%^uċ7S:mF.5|^WRg^]#|KyYe^ZD&VIFߔ }׍|OK_b 6BĒƜN jO߳/~pL@!/&',M3Ӵ}#O[[X(aG (UTpMEpߴG~$xOE񇆯,q"*%RcHʺM7¿M/|/MKXޥ\h.hI7K#oޅX/$bĐ+F(4W?Wo+ Rx]<9./xWwmsfc>y4,Tdxk<ox7dqA*H?l,G u_5?Hi]$E6! ́k%'čZˏˠ/ϩS8|Kx.Y_0{iU 9Rj8gEǑcw߅$9`FѮYٸgzz6о 4Rt|x`bB8GP\8%SPG >PHבcU':97O+xOt I-qoonZU©,I$ _L| ,?F-SF '&\f;=Fg8Xp*=7_'}xY Z6m5ŝvc=+^K)b|?O,gi4eN9@OoqgOZ"r;uRc&YIZvÒc8 S!`(QE?m\'Ik/+5?3}_W!j|hZJAQ_nQ&?gM^|9oxQ}+BFInge8Vv@eAg{W9|e.ž Χ .GјGi+_1wŭG#Tm<4u8+k|4|؀2I; 7KxOmr/nk)|8fzW)>,UlizB!ne#*H?:1I;-_ Sb:=9gɹNno|W x}#?mB[[O˶)n }uRcaI-Q@_"^ா P+E7H^ xi.n gBFˈWl?]o;m*6 hW@-~;xmaff*!MZݤ$uC#sA@<*d *`qV&W_ ximCO{}-PH7.*rWѷFF  9jp^ X}:K&ֳnT5༺?K>4 d-Ķx~͠b]x!bA H@V?F(#4E0q'ύ|B CXcjeA%g$o#\I?#.a;-=cܓ޿`m1m?ܮמ3K+5xPjϵ]j^KSyIvj7T>$x3B|U GҼ躭~ln,#d:v2eHP+/g_ؿ?~^ZN >,e.ӭln/K3 ^ !CZg-N9 LzVv6qaO x;o>#xۿuWp~{_c[9O>*)ʳy~p2MxZ5bf]N~yLsu,66IV,~Q@EjYhpyזq~yV5aϊa| _h^#ί04hm띃>ßC^K-u8>)"ȹVV9okڥցj׉Y䵙22JFy~O__u|R _PgU(]vbBc g\ޫxn1I)MuKTWIMFHU{˘#|' ~tO CǖMyd/ݬ2my|y4ԭky5?gi|5gg !C4]B1,f۴єpUGAg s)h4 q͎i4k rFrOX2I$#P2Xs@+;_H]STӴؔngHTRX.ǎo_nτƱ}pżbA$7Dz/OW >,kC5fc`PW)xovi:͝s?&__ zΥ_ f%6jOay<g<9=+Tq 3j RE[v\O* x.d(+XS1) \ÿ'1jIWڹR r+M+HWrExwĺ?M&LԬ|Mmwk)kwG\a؎E&߲!EjVL^f.2k >B,4vۛ„31gEozu|D񇈯5 7[١nDpA OZc6|;;?EiֲV;` ~pnwk;Tՠmnm2_W1>ƐGUHu˨(dDUEUP\ j^YP X֭Xivɚ!_w 1sƟ.<B3$a$###c[%6S n H|IqfU`..#D4fsWkG<21Qjb@7g8JD?n/+'?731U&$ /$1f (Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@~Y)Gchl-$ix&* pO,E~Wo#9|'*4qx;_#+?.&W8 2y>!ǽbU~|K?ଟn9|_kiap>PT((YgEԵ 4y[lpDYݏ`OG 'ok_P_unVZdlJ#7\rs_7KuO$mV?hԚPVH(7\oU(&T1x Dܿ"/~ />'x5RYИ`Gڥ]ҟo_._I-. $,QU*3n_ ?࠿n3V:ի-Rak RT"쟮~_xRvm>ҪV;y#I #|v,Aԫ>_kxV)]ƴ*]"9(!Q?Gofoi>~> K!&YmV5{6s܈X&G_+NM~W˫_.doM+UTOq,>:wLYL_5y *Yd rxk|ܭ`UyF3 W:(g OhM_h`#D䭐}/;6k'_ ~lVCo7Z`s17wۀ?G7(|?gZhkuo'GF.l0>8>j//ukc 6nq__I) XXC=ҹYǖwHQ؞IbNO5zt`>;kwL@ixgc5 "z֪hA8$AOcJ((9'{ڹ3WNG_Vkg ^C b*WV?'Ew5  ֔#iHs[0]!T8 _WR@K_=F*޳<k5rfVdUWbW>%De܉j14ȳʜ;cj[Zľ#hcIxVXVuRzgz xNԴ[[x_Iּ-&Ge cd W/|1Kczep淞 X{(?H;dYӭbP".獔d51"?D8a=/VbR+ǢȁkJH?c]A!EP.'Kh$FT5,z(_Ƿ?oǾ9CD,MvH@JOz 6ˏ Z`!,v34`X(WnmzGmEa;^B#SbG==k0S}(5 u4 ;%b[*.'Y̱:Aw| τ -4H)(P8OH߃?RYö>*M/źl)?Q~,MA8a2&~xמ,BZiĐ»ϱnqu>K7_O'k1;4ϙ';PoFG=xa_Ğb,[;D "\dfYXC Q_mۧ,ԭc§P\QGϿCO>!h-'/4;-zIċ 2+#vLuiᙔ`1_8'it4wl7%,eDMy@*_im{VVV0E޿MǏпҫ3 -OZt?KlWDv)?x譝?jW}/M/jM%6O?t^GK8_ב+w:_y _OWK_P?_;Y- ~ 3x"H4z5"ą|]:a)lĒ,AD RO¿<x_~-&!% =II9q,_HUT/Œ M}]A'?[/%߅#E6}G:@DAf0ZLHS p ~;<--Ėuc2VhesErr tx?^>Sc]N8ʗr(*'+4> x?őhOYT1< /q]{J3K_WᧇF9gcI?ZO[~4>"?5?jW0nr[ k¾| [zh]mQU Ut9.f/$DG$<s_&}ɿvyc/Ԭ˚CII0~>t#+a :axoǞtՕΣag VM,h8O=$T]$nkm^4վ!\* #_!0+7/|oeۯ\Mt 9Sۊ W= ym3ù' ^iw--hgO-}k¿3=~(؀k_}c$ood|?{Z֏ AwYDdw`Gs@c$oodc~;FO ? |a?KƻKFxŧE²|or Dn⿶hfRepzCRQA'3?3<7>A7hyH+=+UiaEG Aº͌)Uu3጗Sd£OI4Wg'z Эa!7:BhX\+ RfO,#wpzt?JnK >"u&$"7^Q>8cȯ?^i0AH# j_QoG %IZZ6O(Eywfok_'<7gz<"( 'oi>92|z7ڴ=Gl.溞Z=ֿ~r3S-+^u7Ot76Wqop`)",? Cf+g­}~xoK xMmZ;:ŷf!@ g(bF~($L|37ׇf_17ׇf@#j|hFKZzO;O(cW+@Ks?*cV |Y s_TJHixr|BH` J?b&?'׃IZ1ujLt#;jOʊ0W~џoF7>!OvWS#isw{mS@Ok-)/PmniX# ua I,*b)Uʤy??ZZĞ$xk[z<Ƭ8#_3Ğ 4}G2(gd4SK2Oo MzID*}pn NjvpݨA"0nxGjUE!`K/E?? $Oձ>gaii0z?[ƿ_mixKG]$?iR8Ȭ6/ ~̞犼;euƚtZ}{nð΋"iϔQJJഛ%Uk[]hUS$ &3(֥6g_xHT.5ڷQ\ %-w<+Q׭Kqs{m &VjĶnN3J8@?V?I?ͥ\UwV?I?ͥ\To7iM;|yC]o4kQ2䨇ɷV<SkWWo>J{&_/imHA'yoϋjOz猼Qu6_jww"}gcIPg GA_K&'Z};\ѯZιB˥P~i~(1_WX o| o}:Bkݤz |PM|9u/N|yao#xk1öJ#*Inx*GuVVPh$g|h:wzat9I6SxW9 fy=~B&]X;]d#Bٌ3\ ox?v $Ŗg$MMgs}A,zC_g?؃w$o-F~\Y[ Es)~WqP5)zƅWJW eWҗ"})LQ7~_A;,+Sky+ cl!'b?{_ ~Ͽt Ú?|7°Zie p9$I|hTe_ (->F  +$ B99 _GPHQEf9#;?,Ѣ_ )cm*&ho%q% 눔t,,(쪪 3w&_&x?ڼSm\OsOz  |3A_~k]sEW|^%)D9Y9 IFQ @Ɗ+#(~.j㍭%gwqU{Lfv'5 !}e<+~ c IiZC_T&pA<S|Oa5H|M4OO]O)GB2'@x Q*~K]K@R+ ]_:_A'{b~l^ )?wqD}EPs͓sk7ß5'fkzFoĶ\r|d #C_?w_O]II7hrXM 9<(?iaO­[o mzVw7l$IGb  t?v0~U0+?fOBl|Er\Fl|Df9P낤+W#(iAƿf4FJ e ؏S&^pܸvFGc%jsnMO][̒]YHǖ1O9 3p+ +x_x@u'O^-14M2m(#03 wx?6| ;y>^z {>$1֟<SGo@wwQXIխ$̗Rܺ "}gAS6~ӭorC'_}~N_KY->*b[ 높L1eiȯ*Z?WG(W)&ԏ43Q%ocB(%?1-k )aWJ ~ώ jY~)EPHQE?m\'Ik/+5?3}_W!j|hZJAWO_տt_ mbw&Ӂ(n0( )`Tl;U[؜W7]|@X7Jr"m33`w&GͿ KMxb[[ujw"ş{ p2y$_ j,Rx㖏 EY$up9|%Z~5#Ʀ0ӭ% o؅w+k !x{QeO-.rp#O ~w_}IxJ|@w|1-rTMlq,.?b(*'L:edXP@_#n''ÿG} lj 2[jVR3/eUg\g҂Bj.qyyqm48Eff8 I<^g-~? m_ԾJ}Q}JOy0ܪ+WuQ"e+$eXc4_g;yď6Xz?p?gga?nKkqx-&K|!v|yLo>&~^ < K1X-I=5R`)7ÿke{Soaz6e텰 (t}VYehѓPTO' ?n<x b|OxRk;~1ͻx/vzm^,@JNez)_U~VТ?9Ss4/G4KcEA]ӊh7ؽ4WEɾxCI}2O?t^GK8_ב+w:_y _#OWK_P?_;Y-$>حm|7H|Z %i9_7j]5mUJrnj p ߳g޽ }jWm]O!C)gr}MxQM61m umG?I?KiI 8)n#3ϟ; QWVѴ=gP]2Ѵ+)L@aI8+>\jݽS r>6Me};Q֕S=&A+ ~sFgǯ!h]2Uf;Ul廊9<`yLiiVP k0ā#aUTp zl~XvmjY^ FA&Ҿ lz_7>7p2M.bgym`u9&>^StXumC&**7cn vy'CZ9~(؀k_u(GђWo)ISW(GђWo)ISP c()ɀxx9_LbC__xOwIn+ U_)?4M4w6=7EojDA1_.Gϗ_*[#YWu_7$\A4M2PI~?ݺoF$]J>_o}k0t # Mm; X&V+UF eH@H(~>'Ǻ_ŦhZ}üZȱ&Ve{*X԰4z~ =_8_z?xxFi4 nr?fƏl b5B?3o-&Ŝuhשy,k0_VIDp+$y>4Si4_ î|DިSյkZE5ԤM' ⾏|O,{ɚX4=7DyP2&o&:~5Toj^,a {Fbh?fwM9|oFu_>q|BI>+{f jZ4>7u%? o؅w~េGY jѴKnjF< 1 *,@ ]ĭ<3$vp?xC_!+vx%q??xC_!( vOU襖 G!_~5,u{} S&d?"l~5QWgK 60qkMہsmᏞwSZO[][CQgR_+ʟJZjֲY^2Wy!S`" {r 9/_WJW eWҗ"Iooҩ 9 4U5}A!_s'SCƽWJ킿NzAQ?/$gZ:q@.~ؑ腯$(^&J&UXϷ507#pU̪TAҿ_;Mw|^-f!m]e {$g=(*'?`%b`CSi9Uؚo|ӢsQ$kFf h[^^0?9Ax Q*+os[O['?(F8UE K`=' Ɨ=}hwـ ./u/ H4oQwWE/- o rƗqo+I~R+ 3Es y6~ [|ib@_M/?| sjp^_jZ%êfT*'$ A+Axp~!x¾ZAX4vsD2c#/_??Mm >>Gu/mI-avOZh(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((( E:o[O~3xNel'a1#kOS/?5 A<#_ ZݕrJd_y/[ /ckonmz1sނ?WUe[htD聾GK큀``zOIi ~鷟q ɟo_x7MxRFM.Ԣlf+T-8! cGT0[߅UpD綴,6ItXk~~iZԼV0qo-5C{ hm3r>9R M~|=s |7]HׇtxEigg@@_/zz3݌:ne>]HdprI$I'5E?q&ԏ4/Q%e?޿Q?ÿ1ح6q>wB*D*(*EPI7ֿAm_k?֧|hw⇈'>vk$U"s?b?2ўYMB7WI$ @X(QE?m\'Gk/+5,B)xa~#M>/1ӯ4MAm 627WGFSOU&Y6ojZNj \ٝcc5PYI q@Z_w^fZ64D[1ϓ$mL ~UM{ANuVv[ZBCse Ah)୿?? o6~&𿈖8AۖR˒9X:n`lq`U1X Ʊ;{bVC2p"}j/5'kMCYM6KE!ܖ+yc';#u@8UQ^K3[fG7>1|@ִ>{[]>FLIVEq <;? gf9ESO.A0q_)b[| Mlׂ:okVz5˟ZKg-q9P𴈯#hsxA` 'ꧠhvЬ:| mob\hUrrNA!EPzWA^Կi/EΧ?/,b&|/۶`qr!$*;hmh]H#? ?S ^O|/֭ܫ5ƗƧ*INrp&O4o=6XuǗzk`?egķZ拢 i&-d?7V>,"5< $43/:r]|pŢ^ѭ#g_@ҁ~dFzm֋mf{{If2qaFDk+ %i1<[_h6u &kHm1q!dbv>ePGW~?nwkz> &?N5!j;mlW13 }( 9?<=H|7YgxNL"%I22ڿo)# ]k5.7XY֙;d%F bdW'Giw/gR\i][u¸;]zN $? |o{*zOOhX총nKk21[^r>IcT( _=Gc~{5#|u,w|GqҾ~u;k=tio|nKzVڼE3>jٖ{HZAsm=ȯ(cr4}%M/TMk33A#̑H+ k3q:)> o>pA۩LGcy¢/.4oi&]8@r nWE ?9~<ƅ_iiOZzhk⧊|}xĉlhڴqݴF9bka2I?G?wݯ_[O~jjb TgSAWh7ؽ4U/xz4B/>T=|ȤR$dh$.OQב+w:_y LJ g>*M71ȸKd8ly[+88m].s~T"\{cG5@ :%h-e/bIbĐ;(f$ 7?+C}[\O?xwV_^ ?OM[yi$N] %?i/+_K__?ٗ=wj46scgCxFAp 1ҁ$lc6׫~?4K'>JIwewm&=g~ YoM$+kml!A']5?S[ğ |{ig112GE*uR q>Rׇ㲴.Gj~ GndYem&(~+x.^YtZ"mu]+w_"!x8emQZ}~_؛" |'GvN| .'r\Hvl3邿s^%њM~E|.A|'xGD(I]~\>tnX\ ?$O;O(cW+_#5^ 6ojZ׊5%)n]c#4PX u3[xk ߴ,e!([#K$cM~y(?ﵟ Y~"<3{;[èbU u*27oB6wVvB61,D# A4j5#j^>&O}zYͶpiqKiyc=7DPU_QxrI,~}`G,i= ˽"'ࣟGW|=7|9? k;vLs3E!cm~x# Wk/>1|@ִkk[ Kr$Ę#џ؃ [ Y߅~ nT ^rn]G[s&\X$4B|%վ|Ikۭ&y%#qC3޿E!`K/G5m~>x*ڜqGg,ұiBEbN@|?E4 :f;=>BŶ(U<94 ȯ $@#|Luwwj)qo5}#[96v-b,?fO3}^hڤ-myal6q0G$n Vȯo uii|CO>s!Lhz0 \+3Pݖskދ67bI)op`*Y][W5+?Jy>e&~H@டKđVZi6-IL6[?7e"A5N^uf;H.e ̌2UC<89__Zk^$:[|$4TԭBXdƌA&#&< (bN_ȇ!ͥ\UhG|KO4iizpa 8W^TE~x&QfE|Nú:HdY#Yv[eF@eϭi;y!4Teu<AREʧ;&WCĞ>(i4]F8&$Xi$}ͤ(3_ɣxNM?73[]W{8bKm"0{y$F<1hx:O|5}^h-oycl6q7 F૩C ~r~jw?xV[\2$juHG}(7{?_nG )ipZܰlѩ~c8P0@CivoeemoggiF#QUQP&r\m+K5_;~ԿUXվ&iz׌)umN ;XmĭFdC1'O{ /M_fW.~^~_ᯂ11ebWr,Yff$  c^rk?'4e\jyIK]YXkP)erI'c={P4}E\#L _GW+?΃;ρ|/o5|#iK3M"C]ܳ`dҺQEU&5ψZҟt[*4iֱ.>|E rlG6hxYUՁVV`~ßď'_ lu5ȺC>ۓ J˽ YYO*yKo=ĉᵆoCX򶛴ldts>n_mloWxĚ^.27fH4Y Dz(F X~yN!YSO_]}$AWG?_tX[j߂<3m"#CI1M+1UF O&_|?jw0WZoK,ٕb.* oC I7 åN oc_D!!/ \?( #;s\mk 'CwiBӿDԒiȒG"Y؂Os0FjRR Ԋ??~&j3\jByHU@s^A'Wr?|=,|=EbxOc26^"x$wa 7T Ii2a`vms hRp kU?sG>4m;Xq 6pi,R\vDh Fk)6Ag|2CZ5u.r8utxaW d ?k b<c\[Il5H#b,UqAe7TW8:WſM!?&'=K^>$5 &ӓUnfvV  ]C>PY}(QE ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (c@ EgxKxԴYO7=o'riQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?ƏL iG,Efg[M?3-R Am7hGI4r˰TVo&z? O=o'.iQY)?Ʀ׬uimo-nFXE*QG+TQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQETuk//#U4*䏠 j!ƽ )"c4u5R $|WR_CW}5Z3gj!ƏEr_CW}5Z?j?W}4m_?j( hھP,m_?}?U.Yھj!ƫQ@\}?G_CVgj!ƏEr_CW}5Z?j?W}4m_?j( hھP,m_?}?U.Yھj!ƫQ@\}?G_CVgj!ƏEr_CW}5Z?j?W}4m_?j( hھP,m_?}?U.Yھj!ƫQ@\}?G_CVgj!ƏEr_CW}5Z?j?W}4m_?j( hھP,m_?}?U.Yھj!ƫQ@\}?G_CVgj!ƏEr_CW}5Z?j?W}4m_?j( hھP,m_?}?U.Yھj!ƫQ@\}?G_CVgj!ƏEr_CW}5Z?j?W}4m_?j( hھP,m_?}?U.Yھj!ƫQ@\}?G_CVgj!ƏEr_CW}5Z?j?W}4m_?j( hھP,m_?}?U.Yھj!ƫQ@\}?G_CVgj!ƏEr_CW}5Z?j?W}4m_?j( hھP,m_?}?U.Yھj!ƫQ@\}?_l>qwMNY.&UŹIY?k1 bxEu掬eQ_QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEU$_f@ )"c4u5R $|_Q]aEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP_kW]~sWұ^ȮӃ4eQ_QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEU$_f@ )"c4u5R $|_Q]aEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP_kW]~sWұ^ȮӃ4eQ_QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEU$_f@ )"c4u5R $|_Q]aEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP_kW]~sWұ^ȮӃ4eQ_QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE6?WtH&=-DܑPq?s핮_\IM KvܰZxWOi#wO=hꊊZ| I~^ 㺿Mk ֚-R[dgGw|9/ |M(_^]R:$r,U( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (?*O׀׿U$_f@2J_䏛P+(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+ b˯O5N{wV+o_:pƏ+ ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( __pssឭo/Ư%KqrJ0>a[,w?VM.o hC-z#n6WY^c>)x-FS,;1$eqwyqqyyw+O=%F%ݛ%I$rj#@ O@:>y]fMl GPmmmbifIfo m3ɢdZd<3(Y*y%d9XN0KGۖEFea]-x~VQCmrpdY؊%%DUTQP0vҊ Š((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((w )"c4u5U_IƟ# җc#o(3 ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ?g:!5' 4m㯈P%X;`̽SrqPY`T5W!(Yէ9(CN7XŞKw ;~k+9Rӫ?o߶|7- Ρb\4xrt*GjΰWnR/*5eJ{ŴAEWdQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEi|N^J~e'=;{+q7z/8?G~QEQ@Q@Wm?:|+6qڠ1Bbܧk+?c?w›{ҼGۏjS@YE((uH'/T\ŤzVȓ_H8ş *ekR5Mv{CyqǓ[:EGwٺŹ)G=:q YQ_1*ਾϷ6΍jCN=ȍ%%OHHl) (H>2$jjb4>!6\-BPYQV E~jyZ~zZ"&Ȳ2,@N=OZ#A Z+U\4v<5 R0Sjjp2кJI*+/KCω4xWZB׶ >rFgZFjf׳0Ha#xĒ_t@%u (/x]Ht_ X rSAE~|RY| 7:ZyCXrƸM* W𶚝rnۆ1Е|3 T.s_ia+T9Ur 0*w@s@((' +k(GKU AYQ B| 7" Ūx4YFE^d :6:bQI?k=K՟S7UkhkwPr<I+ |>"O|w!]Û_I!L׀Kj^Сss[x'<:s^m߶Fo+_,V 3B9#˷GrwUOޕs틢ή8 V̭rv98^ {Hg-WK6ndrT*EfEWa?/m[xpU|^~n $?J|A+={֓-PO2MKkY?f((/K\X]: ` =̌qƿ4`*rHPHoyAz撯iCks2g c?{ 4ޮ_E 1O4%nt}qHVdZ*+aoC o#ִ]`3T7s|Ѿ:Qʳk٨QEQE|cy % ìwX񧋼d:5mi`RfUU YWfxg/@ , =X+fsƑ,Hu;9 >gf'F 3aO?]I7#?|9b5M~k1xLscڊ~|BAOqi ?x{~# |2V=4wfBKɏ2'eDnb((W>|3$O_|EVn4ฒ YP1;0gJ+?7;>xceq׮~?yN~'|!}rO܍5A*&\bI ٟQE (=k_>̿5ox:ܺ~j&`.cmEnLr<2]֊+#A Z?4ޮ_E|͢ 4ޮ_E#A ZW? x|;D7 =0} O*VėukZe[{{tY݈UԚТ3k:k4˯|c-+ c ^͵\[AlM~u Yao%ϩǑcѰyFh貊X59%^*Vʩ7n9fi_r푥~'Xsq&)M=Jʊe~G k8T9Gq{?xsSX^KF8smIc@YmExOq/}b_MWH4-g@nӌ#l@((՟ do|c➩ứ,uB=A46(dde`Paz½ٟWFȴhѽ\^@r63A.F0LMVUĭῲnle^O9Kr{tqg]_ii?l<7^2zo&dgn,lr_gicլ\(x"XpA(+οkڣWO5'/{q5yݘ$PăIWH hDz?>o-犢y:-1S֩hѽ\^@YE~hѽ\^GFȴ+?sh/7+h!z½gmeCFsz-}|74߄ڷ[,%ѯ70!cB$ެC(QEQE~v_o-)it|BՂjwֱ_o#0͓kJjĀJ||AOC_vϛV]ޛv~UtגT@BAlXGޯ`D*ZkISYNyBsZMx4%tPqvOYf nJi=z+?EA~ O=_ԟ7_(ɟ13eG]^ /i:ժͮaH3?bs8\UM(0SqZqiWM>;3Qd%f0+rB((('Q@9 ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( 4_'دob2 bEu掜t?k(@Š(([O#_ڝGŏ_+y+пd/;τ<_r=B>ނz((+O -~W&?[r袊 O Bc_mr4о2m6%?GOy0E$q,bbW_GS'sg ,#EPX rৗx?^<5tRi_NX'˔0#{3+g!e>>ЯJ+/7 9 5~"|5=XMOKć9̐2J9(\L7?ZKoJ0(kF/_U|):+lHg?*՝g =~8؋RoGu"O"=tSLx ?؏L_kmJV؏L_kmJ QEHTdp, YԾZn[&OiDq<g!xh Ql{U?&ED_Zq%֔tl/n3_a_|9;zzփ6'խ:u<2(ʎtVgXx_#KmvBD_tS)=)Un:P(h33ǧ(%hmdc__y_?0_JAQ 1PQK /2l}V\?5M3źrVNgnpd1PCC >.3V&2(tu=ՔcF}+ڃxLbMtz##gg& 3m #_sX?޿}/9,jUo@W<=#_pŪus1iZ ?ȗה?-kR"^^P赭J Š(('3i |Ewm#Cqk\~du# nW;I/?w^?QT{'Ҥ(v?/~<96,eZilȱ$!䍎X_e1_xg[!Vz/g[t _DD·Lsk퍯v7ދgu2=NJld HI??%q3;d| ?sz&EDFhr/ڣ㯅Il_Ğ0]?NkFm\)AGE~(Pb 9oW.~pڻ uB~l>׉"Դr wjoYYdPc|:f[/4ݑ~k9_'/|\]#?U1^Or(щn@|Mƿ_ZxP,um&Kմ,omd1\YXrZo}`@kud(?v"jVY]W* Lp];s_RPff?)go&앯|L3Gq5_lާ";݈#tS@; Y=ckVc՝x,Cy)e8+|hkψ$?|-z*[%,Č0ԿloZ׉wɳ@#0p0:ğ? Ph{|h:w7Ķm=vpp?FkKIJGU^/+o,ז?%|+oka]6TXxnߗ"j\k$@3y89hW5 \[; H!Ԃ@_Do9zGgxՑ H2?6D) ހ?9__CK_ko7ڇ<fn<7OZPavcIm(߯h3 ̖~ 扊IΌ?b jVGEPj jq+}dbh Af?g_ߵO ;m SM!nmA$m28 rf_wqiݼrpOYO-oJS_;Q?(?G{@Ȣ(,3E} +7F4j/c_ ŭ$΀ Kd)9 _+g[!Vz/g[3S?dDx  }N9q^LO+t=_\?¿03X/X.u;։afdi 1@;(+QEQA8 kP;[g8Xc@Y@??Pv~'|PI (zKqx'ie;+a˰v^w/XFW^3AB5M_ju d>ꏢ2g6=醚 {vX[9L'}v о0ioUnȚ}QEQEQEQEQEQEQEQEQEQEQEQE3U_IƟ#~H47x @e7W~EWaQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEҽfT-b_[xM÷/6gH+׷2\ȑD"y~k' '5 [d*_ ~xpǹ|((("W=xľn]Z/f;LrdCW/C ¹q>3<&.jSqd$M;TP%8;5GjGk{y)cqԐGb }~J|I&k?₷t"ҹbFqV>D z:vx[<;WU_<AׂedHPrA޿ HX0A_ӷo %~qinQұ+QL.ĬI.p#(q0(kF/_%Ma|Qb֍^;h4= )#SOVuWU|):(&A^'&zpY)k+_"?E-E{-?E>C6#S;g꒿6#S;gꒂdSOb xt{YO{|h F5uE~ղ,Ko/3ae/CA'w=xO[/4 ˘ƥ4dp 1ШPL(@+kz<3e-7Xm֝# 42S^E V%NJ?xKSZ_xS^t u;U`% EdUXpw1gn6|a6Q<9p$ktc<[ʅznE#=E%eZ_hq^6|Y x[‹h1-`Xm.ƿ La'k߱MnO&G8VOZ|Af~tv9򦉊pFFC +~pމk/u_4;#/QjXH,! GFGAG}{ek pRVI'^"IdXn+h#4'|nex::MarC*CppAAWC_iio-oFjM{-3ӌ.mT"ȫԤ́Ua_ϯe'1/ōSJ 2bƩV;5s1iZW<=#_pŠGz?yCֵ+/%ZԠ((+$/]s?%}h%Gi*J ?w_M"AL_c o릂dQEQ@Q@v}?w?353HWTBq?~ӟ/ \ú,?=N׿-rcr((; )f_#ƿ.ځs ׼ Oy?AgYEPfUֿ w\_A5.@6?+ֿ w\_A5.@6?(*%)pkE_,DOKc\?.J ?PfV{OiW774"6du`C)93 O=imMoEeKqϷȬTaB>;s st,='cKD>ZHme(R*Q-):H0U0z?E`ÊZ )GF"x O[ ]omHH $̷H'_0PhzLx6C,WVy4[֮GMxۮrg >'xwf6V OȄk "3_7DI SSڇ}ZÎ7e0ws qA2?F#zxOڵ#zxOڂO@pOU '*_BKD_o1-] ;?e_~uOF폈;QjhdJUԂ>JJ ?_)_+8l+.P[R+WL-m9h1H>_yK+/a*j~|,yt|}Lf/5C.zy9hm*~f_u~㵎t״ۀ;kgS"T K5<'eHkj)FXQAc$a3I O1|xKp(QEQER5-fxojyvsjS6 HUI'Py~kGW]>~I}BA[P88;- _z'oFj?AڣIkw#ւr lFS^wA;o٧J~>{'x]v*1#ڽc @|}9AӮ!L-K$Gqrqv?(|g5 VGCI5a/[Ev}9hǿd4 >9i֬d|ʪOՋ7`繝a@[[_ ~#~# }F VȲ( \bk3@e߳>"hR,OKMfQgd(}I*GbWs_hjaVtj_ ;wAnMehנAQEQEQEQEQEQEQEQEQEQEQEQEU$_f@ )"c4u5R $|_Q]aEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPE JͱI= W'~$_\n0a*둕l_-\mb =9>U)Xok{j:*8Ћ]'B?A|h#?|+?a3#_̿̾}۾ g[׵Wr6EaןɌHz$*ۿ9|iux2]xm&X֢XfXmԗ|WE]?L00r+  k.Bh7odPB`ExC_e3֍\iFcRiO~^u#nQP 5l|cE})? ]DB Kx4k!}Mǘ;cEٗv ԰>dyj+猾 C ئ`pnnrҰ?Hc }/|ge\gt5;S7=,m:j~AvGk8"/T S9[׆Ğ+,=s%3vD]ePI/c )/n/K;f0*0$G@"%?t~ >#brra:.dֳcvS&oar~]"O E:~44mO}YxO (? ZA#^Aiyd\.{紛OLwJ_pᾕ{U Cexb ړ6q]]42f $T), \_ dɸcK"L\0*r֧*:'ڔ\]d>ξ.RWNݷ_~x_gÊ~4`E⟍?__0 e>e^U~$V}ҬZkS82l6bMx9Ҹ('~YXWKt޼ CGc΅+z ?(0(?<+L;_xWwIn(ˢ(4??3KM '1ڿck Bc_m_GS'sg ,^" .L4ZB75ޕ;*U?HYqn@rk[ ?oxŚC}VۣE uVR=/Ff K/O|&e|s6HF~+bZ(3?:oS o__t-h%C???ʯ?g_MIeWŸzdRoGu"O M(b.RId[Ǽ}2=tS4>b?3 z+[b?3 z(&A_ɿQ5`--,15m6nȲ?ȯ"(odX|mN&ON?*'zQP2H:lYn~ > w0ŗ"m7goR-MgcW濱 q)K #N5(cP0 *0(([z]ŕK5MѷݑA"di I/j:A m>X+ F]h xSߑgu7Nq1|₢|Q_[h*ZJ ?s|w~xFIaZr,r0g y^_*/|;1@ #c3??"aԿ+*}"aԿ+*Gum"yHyQiX׾h:e vw c1 5oe?KF'd?i$։}jL,-6wvm21WUSv7\X|f^\ӵ`}!I%zI<|?qǻj 3Ie8("oh;x_/ơgioIs Ӛ0j8f"KW/Wn:{UxN bLSI\=Mk2eោ0:Z#ZO3PĞQ43Do_Ysҁ(("?σi~ 5&ahq'΄8k>i9 *WVGEkGE^ +/uS@pOU _o1-] .c&Z&AC +kO [mrCJ[ǐe@E$@I|dֿh.4-[@~x~2}A)+{|E~4U5׉?UGXv֪O]* 4 W)n?ѿd^$5Xukn9u@!W4 lv_[P? J5Z갸*O|Dʌ*YO!#jcw_wSP,(1Q|ylnc8ik¿|on #x^;WM+Snr2qZ4ZA6? +EkGw]?|HŽ9OBr+_/_?;"Z)g+$Okᔑ޿04=~6 sO#FȲƲ}j آ(=+{~"ϑ\|'Wc8Z"=.+QWWe#WMgZDpݢ>cӼT#RlY1A8NQ||_}=_Zծm(]f3Ȩ Hy膂S xG}k}k%,d6mA; =O, X-E֯67ۭ ?{ï ~h>VDޝoi`5$+f3]F%FF= :ɟS []}] 4]~MQL@?|AU[s =6eC>Dd{HWL+g VZu5G{eu mxI{2؁_'GNXٟG߉z ~3`&#+xA<&Y~Z QEQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@WREik߿િ/?3MG^_/GߨQEfQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE/i?^ dY:lc c sAz+Ͳ|iTcZEiBiJ2]z?4ZtRmIlGK#/ퟦck2ưǾ@y~>e%_ͮx{X4D6FV=E~*^&cglOg P%-| *}W9cY}">s5~(s:g%J+YJ\K[ߨpDi7kgQExQ_U?*O>xP_}:}V r@N@?[A /|}G"ȣ{9JRasViZ*Rm.~iP[vpK<XK2B%ˌSaF2G+Uxk4դh +c;eY85-FY//.&<9IYI5> gÜ:1V"isj5nOJZ%uXV_wvA(((k'~ϟ_߰Wu05o.@|?nظ r\"B0 |> Է]M5ctwlIW>(x_&**Ia)UjS⚄%- Ve2Z+jɾۿoOڇ{aI? <+sŞ]R\/.-h/-6Ia Cv~0AOKˈ$Yʳ!ϖ*X+ GzbVnyV8BRIK٩7N2 B%%c{*1Z,G/+-mZzEWٜaEPAQ@P_T~oigU4ɦ 67O~Bs^~~^ [tY~K)17` yk@xh>%f>E/h}NkǯnG q3v䕩)i&W63Y]| <O`=qOCf;]IVMe\Yٗ <⟳P,u+;&ii0xQE2(̦$cf w=x:K2I#,q 31¨I=|yh_xOֺn@%pH+%.(/4/<j/3KM '1ڿch"[=yO/?zz?;?(^ej]%K҈>R: ?U/ P\a"lmın,@28Zj<qKA/.YXpUSAcK__rzC^~@"֜t&^>45O'k\<kXOftlK(  #uGREcDrJH}Uo (7ŏ[3\fͨxy}y2Ў35Bd~{oص藯tkN h?q:`~_t{GgRG9U8 )#SOVuPLO M(b.R׶WI?EZ ?O[Ǽ}ߟlGw56_%+lGw56_%+Oɩ\Wcsg_uX|Ԫ.>O-#Vc4F_PQ|) AK#lۊ/k1|gχ^^'Ya7^AQEQEW[wH(tܭ]OVP;EZ&o,Ooc;3Fpm#oA4J)=悏*1{bʟ-}w_:!+'?$sZĩ F+)!v~]gq$WO:~Wq$WO:~PTD~, ڿg_OQ8/m Hb} xvէ]?ENQ@Uf濎>~^𯈬fAFJ[$h#*G";K ~eh ѼpbTńԢlL@A'SՉ Dnt_/xFGQU.W8x2#`/FVe<\E_MYw<K/o4e7r\|J ܎įeNb:F-?KY~/G(Z֥aEPEP\$(Ez諝$/@{G*;ORPh_D%>x_t xYRFwބ0S+*k?c$\ EV_ goD+z7O=@4 Ю^12ڇn ]b=qJ?7O=_^~߳eZ7ošF++ `vD%ffff,ĒI;*(O_;cQ>;⿙D+fh*!_eiW~?_@EP@QEW_3/W_wOSA̿Gm@SoOʧ׼ (3*_/|? Ak_/|? AW]gi8uxXi\sJA` B y&FWlq¹h4쟧k? n>(|5qjZi瀿haF(hXYUY $kEbhV> ir,I%ƹڻM+ wq;x0o|_3+Y]Ru-rùXHUDQ?z{,mi-ם;Ђ$;+x~U 7RKK ȇׄ-^> ȇׄ- YE["hz/K+-g7m_i 1s_G' 9_P?O~!ڿ쥇Ekfw4ce)%O^?7]Ox&xXY-Q,(X`SIXC^uh@1FqMyV50QӚ [?oz]񍖥n}WR1Z]vY[>[ $#a)M%>=R̙զS4gA x꺼_|= h1yp$yy~J3I>(!~RO @;Z_;Q?(?G{@(3+ `|;g]xgU_B:Bk?c$\ EV_ goD+z7O=@&f&.)'Z]MFz"[ƬW?oᇎi ,dԴ;ȯ>٨³DfI +AM(s~)?>xZGq޾@"(ci  ;2g|@צ3^6֯5q3KAQCU說_g\/'~>1j*a|w^!㡸ZfD+? .qċA6FwGPʚhbppA`MPk߳E6hU?,!\Fgnr~_?,m/u@\Z=O+p_`?dV|iozG}KAPԭ@{yD"b9+z⿏8z+meaBhr>yoR2j54}wmR75x; wOw]]}3y<`mJyLwQO]h)֕QAQEQEQEQEQEQEQEQEQEQEQEU$_f@ )"c4u5R $|_Q]aEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPyo7~>0jj7_nqo|oxA0}?FoYA%/([x?& 5ѓ19_sx߯5CO*qҔ[bܪU)oGJ.faTbO~_{G _?p/>m#Y<=~ T4叫 s*' _ڝ-<7m/mϭʹs8)?hQ 5+Qc=7(t>kxK_KhJ_ݹKI-=gf5%C6ʦϛKZOF(GXtaK_QEQEQEQEQEQEQEQEQEQESdp7QNB>A~j+V5 dyv¼4َ2\SEOfʤ8o&zL_W2X|KVzA v?->+ߪ ח6zNCIb%KPzj75ŝowM\?cS'o5c@c𿇼]m'VRS-uI0r a! I$v_ֻCm$ԣҿc(/cq^I:}OF'gV91y%SWjxH<'~ۯL4k±kz:C)"w*=|Mڰ.-rҬ/'O]\ϕa60>+_zhxI#M`D7DBd.xu~?D#ơ_COnɁ'Gzk,ͧ.jS7.U?I&~W/i-u (g-C4mU 0~'W_ǿgu*Ǎ{YsB{ns-DOٯ]}RmN"L B?M3Fb>WC #h("e]yV)`?_nmCTѡ֢ 7Zȼ Iddla}EaEPN~DZ孯1In|hC#tN7/OZvR:íυT-a/(<qKQXǔ?/h3>V>,_<xM_ ԡV첣I v)!ڎujwV7YYL0JdTb!W4+̿9c;>&"G+'sʽ jjO'?tMm^8]Bv1D4₏:gSKf}cxş]CJI}U#u={'|xD_i$Ib2p:\}hlHg?*՝gc6$_ ο WI?EZ?)7KA'o)O 5fo 5f"?]mF_[x~]?ǂl߇^:neQw|uoC@D ?/7Kd6SxV4l *}Ͱȯ |W=z[c =1{oxU8_-0(QE9,>|1I;zmƧrpp7L|F 5\^S@yi qE_uJ~'ޫxP66>9ya@~w V}c:NFF̫ |wVY_|߲ߴ?:48e^Uݲ3ȇO84R~]e v(X~Ej(T? RT? RT ҿ%q_4Wp+)X1?g%M#+l[?, :K32(2}3_Psn8Fq\k>l\izRj=~ߵIѾ'isFYdlq\HjtɚFǞ ( (+şVEře`̷;yG8#uizϢοUL-?귍 $/g@QE>$|fjSvw]c2?9&7M2ܢϩ:p;>aE{7 ǿ(_[cxKo O9?Z ?(2 k wx_ k wxAQ.WDOKc\?.Jf"\?grPQ}Y>7>'E懬[[]сVR Zh3?/Y?՝ׅ!o3K"iN١>BF}S?Er0h?_ >N)̊T 3pGb]EaEPEvٻ]KP<5ªfe@x?cd;ukuG>{&}8p{Ljc}[]Wķ3 ml(󁝙I33_'nO şUfn2Xz|Goûuִ;aIJ!L(#zxOڵ#zxOڂ@pOU '*~ǟ.f~Ӟ ]V>Kao{zsžgpjC/U)vc2A,}_3?CjQGwRϝDiz`3joftoVe,o*(_8b]FT 'P5֏^ZDӖKw0$yP (_;Q?(?G{_UK5<'eHh(4?|?o$?94a_f7O?ZnQE ( J+>:i㏈܋Z1Pw,zn3 ks;ߴh1o>}!aN?'66rVY>>z~iFp `{Xu{X#-cV8""^ʪphhK=kzQ Ak6Z޵U3@>NVfUC+sA UCk &G,r]xDAQWГ;HjE9kqxFm&nB(0((((((((((((((((((((((|𥏈5 M+ðދZAV1$񒱕3*IzſxGKxoŒ :_/PסXOu"ݩq_'yqs~XHFt9J㴦ka$.! Ċ 'WF^6:MWqu% UҌt'fdbI}=xP>i!:*ެe,12> a@FwEO ?[L?z_i*ynGcA#.R{0@2C8NXK>'x~+Ԧ|MBmWTkXFN .e/kY̒LrrY$NI4Δ _?־-xCdԼE}B 'KOsu<Ia 8k'/uNxGh4=e דO#!o68,K)`gW>鿲OK,> -t&ϵdž|Ac6xzm7Q|D>e8=˯O;S 㞃Axv#IFVW6hfl݃ۜ(4 QEMIeWŸz⿌&sO=YqA2 ?)7K^^'&zpY)h$2-?E>o)~߆ =T߆ =T No۫ eV)R5,ۣyЧ$ *m_pQA'h՗aiu?b¢|7)k1xcSK A3x*cE~bCS9~xF7u+RodW18xCW||QҼ8[K)8Q%q?px':04aYЫ?"ph{~_Ɨmx'_42:mլAʱݏhH?cCUB n|w8P2{TUK =SLвaC1#^ȹ !xW5w~fsc0,'DR։g 8Uf=ؖ'S@rP6:k! xSy#|c\*NI<J( 8٘U$@Nأox;,:2E]7NTŕw֒f?nJ|a݉-nb#(`D4l1mP"PT`: (S8+'KIR8+'KIR*"??J?Om_Ƴ c(gM6x($h/>Vþ0& ȅw.xܧ (5m~؟~>6We[d -,/pJիrI~^w4oX q<; `F;g9QϽAAW<=#_pŪus1iZ<"^^P赭JGz?yCֵ(3 ( ( ~0%G.KE\$(Ezm??IQDz}*J w_M >+xoM'֯9}S>8K9 2BAv:1~Z|K_>(֟p`E`tW?>%?}hh?$,$A%r#r+! =A? +ߵKe·1؊3h+my +zzb鿴?x X$eAGq O?>+x> <#\h뵄HѶFN38C_~JCG.R(t[[Gc:. Hȁ" ~'T7UݤZJ<.RHdR]Xr0ЁQ ?_! kTl<3Ol|˹/9­ÏR)vدvHVd*ʬ#9?gO-OM,iw~3xmlL5hײ/ږGE@qA-h>FqxkgCG=YEW,xUx-?O3=)ԡݩRUumRp|"L"1ځ3( &EtZ&ED_S?.p+)pkEAGEPf8g*oس yHt5Rms,Fۆf5 D]`UO 0?̗Ȍj0~#˵Y"V|Ttz=zJlnSLo-.c1k22AR g )}S?>2JF̬s%ŗ:??Ş& Z:e\A/ʞz22W~~?e6>,.!t&5JȬ=& x3N< Vom O0"LA< g#:Oz .3'#>)@ߴd~0ZQF$|#~1 ֿ^*ÿ;,V/y⋔'m˹f(|+ǎ?h^)Ƶy_iaG`+ע~_m/ïz,׈@F!\(1>$B_'T'ZkZ2+m6<ҠRSW=_?3>i~_ 7ۮ^뚻moP[EƋ(!d|@[ [Vd|@[ [P#k?e\Anh AR1e뺿!W?cD_u( ( ( cw_wSP,?(C IÚgK_Y// NlFGmuR}B-&Dr"F| HZ}?iG / PKGE_ OZ|K)_>+#|/(xǞƭ3Y'E񐡒HSSShɿ;? a=]5/MzQ:\?){j= oWxM[\)2~/{=.#( k֚no5֡O!I摂"*Y$(,pjطZ60&-ݲX*̢&Iܜ"c~:$k!~?~GV>VK錍߭zg_aD/D4:$ڴP_aD/D5 |1|_g]I"0hJ3 Ƚ22 `oiwWsiyA<2.e# bK2: '/\~şG/'KYfUZhIIfC"l߱'lw@#F9Bk_ͺ[ITc`Gn'] >V۷9m?q;eNEQEQEQEQEQEQEQEQEQEQE3U_IƟ#~H47x @e7W~EWaQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEbk8դF,NԞ)n-䴸ch:0#A}]px&x7?_2- ІRU-QN> Œϩ?n_+N((((((((((((((((((((((QCt ZM֥ky=C't\X7.aU_I?߱mKPVǖú;a[)Z\6ƿ>%X&FhHVS_~}uJpҚJo 1Y}J)Wk?QE~yEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP_kW]~sWұ^ȮӃ4eQ_QEQEQE__*Oz ͏2hv^<9^~bUNp6'~$/70ti$os~RHjU`^߅|?/&>+w"G# 3[Jgw ءy S awEO4YbAuRdՕ6eV.We+5:̯:X|r񵝣cˆ]fNr99=3ٯ^?/ĝ >$|a":ZNK¸ɴ ??Pʥ (<7p2[S % :}g=kOcG_^:{xfͰW'E*G<\n&)-tTL֭%6'ʹ B@w?_ѭ?Is#AϊNQGy?\ ?%Z ?? 5oTG`y|wkB+]:;lt+v׾)!55wCy(U"ph }T8¼O L^?EZ񟃴~4n KG֭%f;%BHh7x1a^7 ˳ffTDTHPyp?mJ)/9xsCk ?}8|_17nw56_%|[|ex^#ͫY.^ǘEi ) A,(`Lc H;ڽ$&*0G A_ z߭~3o|B{&<>?yd F>V\JUoꎴc>Y^[g{e+Asoé*WNN/?Sp/f5t/GN5qH~e%Y]YH=2(4>_[^:1J|TOҿ%{na$s')673O[;x-5<:U@un ޟ6izMvvvЮBGʪP EPHV/O/ůk^&oV3i1ʅ$ 0kj:ਿN/0j_ܱ]oN-$|rUé ekJb?߷§oo*V_[KEuL:Mo0f"pd*X+)Gú{ismㅈU@r($((+.q/jxTeQkb~%4G$3@)# 9xO-?su?SO3GA?4s EZ?P~)E9:?ij}3 ($KX4}?9GU Lh1CsCpBWG_k {bx#Ii'úohzVp.ح`GEPZ i;𾡢66[Ii{gs]JncZPb]0C6zM|Gtqӌٿ>T2Ayj\|gך̏ȼ_oD»XNLy#פ|33iyv/mF&}~i]TT/CQ$PŦi@#b`v)ȯ#`R?f_7V25(vӷfٻdwB8+1o~ x2Þ_iEV6vF>s^WxA:_$<Oyd*ق{KN:ojk K"CoI xmXE҉#HSl@\|s{cKZ㷌ၜmFE oPW1K/̌Ѻ/R:+8~M~<.tU[}壵IxM|3cN>uu䭭ێĜoKO;?h? i8'4H$HI$2 GRZ($IuXqoB/F΀27>'~_[xGVVM֗uk{s/1|W\_໿ :?~.tb+YQȬ(*3_G#.n/<-W0;cyKy^ceI@>Efx>]CkA?20 Xo3d'n÷Y皱_/h|E_e`lZ4+kD,*$tA'>8I,jٖ B搕?JIue_*S~<)FѸ9 "0>j?N?"w/)6xwA~n"[66)$eeU|/\&mrjmA-fAvğ*cvV q j*(hׄ-^qoݼH$r)GV +/+7>;E0~"W_x~XF*2C q:op۫ukwu-\I{{u)%Ifvf'& |EYGÞ*Ӧ+q#F*pHe8<0  M@/|Bw^YZjy9(=ue/j*ÿڵƃGJ`Ʒl7?u}C㇍@;E6?.k&mG_)A$ ]JŘ*IbX6}ME 0((Eo">hM ksjZkgnh2pH88Eg߇o."=s;&`C+) A13Oڶǚ\?3]F|vЫ".j@m})Vx^'?x^"]:R&- qG(M̪X^P hQEQEQEQEQEQEQEQEQEQEQE3U_IƟ#~H47x @e7W~EWaQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQMgJzZ =E6Y0(,݂I?P?OWPMR4[xIqtPM< s'|CMnOtIE}|t< RMP93\r:,uEAt|_KυU4׹'n`"h񖟍sU?ٞ'}ZW~o{~SCmXleSR٣h.=E h(((((((((((((((((((E4Hymi kG!UOS|uN@~m51֪f!wX+Le8,=9՗a'iim*cFɥW0. q鱽Q{)9ڿ ۇƖ$x -*p wO9_?_k|#(aGMJ쮿~?A ;k_Goïu /.!6\lVD(Y@;IU8~m |Ej՗S{ua|[ \F&#UQӓM^2Vi8:U-ti Doi:vix$*C)*⵨baӌiSMj֨T,<w~ÿWp;&o4~k-FtwRl={(=~V~_Y?|lk |2k E&=OVǼG9%rR|D{.+εUNWmcy/n]jЋHyx߳֗W߆.f) hЙ/$ˍO'n C+il!=4UG`TQ~xc~ ߩU֕V)OI|?sLҦ6<蒲_Š(4((((((((((((((((+ b˯O5N{wV+o_:pƏ+ ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (?*O׀׿U$_f@2J_䏛P+(((((((((((((((((lwY=_Sk?tjC%u߰pO@_SC^FdPㅴS<=$e_=@Wq;e|+N~"}֝;vRjw{i3Ex_7Ymfcx2E#iC'uXOo~~\+Ķ/$jd< uP_ŋ?ߨTy}[-nm}csnn~ <$@<5jZn&4֒XN+F<Ƅ2U#;^5dQ$VyH5᜿jxJ8>R{9BQg1aU}P ~5jS1սDhge 7zXO/+&?9 ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( " {GƣC{iW-msqg3,V~AH!X(C!ȯރ' %g_n;,D~eMpATGZ2If"/#TP2I'_Ӌxҍ7n*~Z)B6s 9md5>ޑu6rgpCn6py$L bħ>;xO ZZMd|s~hwVG7a/G%%)ۧ&j(-Rjsl"Ѩ(˿pGmJ_ =E埞)eC,3YB.%_qǙGޜiJ1Wܚsk\c9`k]nK{'s;cZoum[Quyw)k'%$S:Gghzi o-%1MXs QWh.Krrֶֶ׹ht߈kc?Z.aUP=`a Li1OKXs@% a$ uk0YxkSMQ4Z:1i ?_,e~P%$bpF q& mMӨe*Or6{'[C/S%׌lgEWAEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPMQ3vQN&>ey%wip`kc`TM&ҿp?i?d ;ƣm꺁]fo)I B݌g_W^`E&.` u DgBwwCC JKS|d=.9lĚ⿘|.6e>s_8*Jm^ NNVI&\lω*Vx_rR^rK}Gt|Cf]6.myzcSxu#YHpe)FPT$RM5N鶚٭ۯW i2"o'~:-h23Zǚ}2p@&(o_zgۡE&|QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW'=;{+_kW+4tYEWQEQE Y/P|@k7}gXzކD y dlgz ;CP4~gZ]{ (?փD^Š7_g~Կ!ÿ ~.5EX i(d|{׼Ï?k ^>t:δ P?3.n1ǟ/߈?ǟ/߈:δ P3^+?KxRKϵWn߳j~ǟ/߈]U`ߍx"4Xt5(E-Sk$3EPHQEQEQEQEQEQEQEQEQEQEQEQEXVp{xf6oY>%}G>q;P(e'ĿwJuڇ5QA!EPEPEPEPEPEPEPO۫Ns~y8 =~kG ׼iɆ6e@W8H22qA\[r <;jYt9'aD``؜_ _,kxkྷnKCQ _ik}o5 >>fkrM\{H}NWZx?ID,-4\Gwgy=z@h}C-!V[wp}c;,`ɯG ? 9M'kPt6z|nܲ@/d6joGۼogx')u^9MsMMBJ ;@*Ok  4?V|/k( 6ݳ.2#S@ EHy %[7&T1 O@]EEQ@Q@Q@PA 2;*?5>8:XSP?o })!cޯO_T -gA%QA!EPU5SB}fqj}V'"k_?j]ts\f$xvWQgZ]{ (?~'}KzTm^o^h0qŦZG)es ?f?3.nA E_qqD /.qqD /.?N3.nA E_qqD /.qqD/.?$ >=׃bu4sgqzM!H}TwU~no ?~&x?XfwˋlUHZTH60J+B((((((((((((((((((((((((((((((((((((w )"c4u5U_IƟ# җc#o(3 ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( QEQEQ((((((((((((((((((((((QEQEQEb(((((((((((((((((((O5N{wV+.M?9+X W[~h?C(|((+Sh(5cs])ߴ? [J}a7b*_5wS QT [Q@QEQFh,-$pRM|GsecZKO \kŒ];BYۘdQ%(:+^?eM#U=ōZ?ҭ|; ϴu֫od%ڋ=O߸1t g-Z]4OhPoO +pkr ( +h_گcw/-+S޹e i6:o,{s0_g/- 3ԚZh O[Qx[c "ɔCTH.2V2eٍYa@E~iCd]z^ i>#[;t#_{{;Z.H t{T>‡ G9xG=kbk[>.nPd VS @Q@ `}:E|Rl?e\H.. ,v!]F~hm~+Kl~RAӈ~_^Cߋ6]Ht>,#"8gYWFVFñ?OK)_'j2se'ĿwJuڇ5QA!E(j?+i0xKI"YY&E[Ed x5򯋿OC×P 6}mQ&ځTW:;u MpB|7x8ᤅ%`> >6f}f  쨠QEPEP_^|VxB=R ƿFWs]c>>yM/ prh*'Οs^XνmZ "ͤ˅lEv ~:g'68`R%~ݯ]m\>T* e޿~|VwWV .$DG' {+4Ҋ($i5xđʧe`AƲ>|/Zxoz4miokne听j$w8'o@Q@Q(j_+r0xKI! KzoYf@}Yaj~د qh@4W:{O<-i l~a:m{ rF)E6 _ :<B3%AۯVUk?sokX(xdt ȏg!ygqʷ_Oooxv8l-ɓ|dqI|CoMY*Yx}p$p$f'r(*;Kc #:IWSЂ8 ԔQEiO$??{5OSإ0SIǏ*z Sh)k? 4( ( xOڵ'"k_?j/'dqBzwGқl׿?ԿW' Jn+EQEQEW{ Zp%k]h@u&>Ҋ(Ե4>hciCbEf'@Q_2K*?# Siץ~/TďxMckеXopC'nPPJX෶G8XFKME|#zi׳|<PxM񷇖^巜/$nGl(S7OΞG|Uxvf}GXeǠQN+/u _^Ǽ\!\w@{9~Q^s&^g Nj~E>.h>tUbK;p%$2O#=6Y#C+)ʰ=>(4PEPECjv656diGJ9,xz?d_Z/OkBU<1iqnnV{PtWwY/ lT_vngWпO{Qt `l5ˆ p&c1("eaA"E(w<_:i.fK딷GVyP=I +ᯍ_qyOTkBG}6Wۘc6Ӵ"eKwrXX <; 6ɆɞF@XB7߲7ŦtTA.͜"v#}vХMn*+`N |r$ $:o)WSw_,o9GEep'p 0|w _VҴ].T.2 ^\u`~ x GR o%5țtk|DUsȋs_G s C{14J5O“k:̝i.rV$gQ cmum⌖I#pJߊ á%} |v%f@~G/FK) _GS O&P׾ծid^^2ી ?3uxzƇ ^%yX^:20ʲIf&BbUV;yCbB1][,Idn+($4Uox^Ci7e=JpKk+gS_ҷ fi=,5N_F 8e9TO m3ßa|`m^Og;iVF~U_ $ş("4kS6\5ñqhcWO. 麌/x2e\cv21G8 t6ӵ_J5k%ޯIDH#2 TOIk Fss\=IT 殴kVkx& oe#F+ O|;x|+7o-lZQK5."[:b )@??VKڧu9OO[!fU3ʘ;IS\~?n/?xZՎL RV[yTH2jЎƿb_>?w~WtY7kg?,ϰv󭶖G2Ā^s+xooÍk/֬|;ڽIk f?$+?o?jk}|9? Zmo2<۹ zm9g? E|%6M$݈?竐y/jqfI瑂hfb=ZcU1'ԓ^M$_ore԰HBk w|;xiva#[3¬FD6cu;!#2_;H8#T]t9!E{!tӌ_1@n9=+#Ohj2'y:ZJ7G~n4$˝`.xo|]jck\<<+mJMJAiSH3xJi#ĬKjv+HK#Vf$ Mm|j}CMԾ u*0ᕕAg[)N;Pѐ(F+ -]؝h'Pp-oxWÐyw2)vbxXEI# TOsz¿{(,4}LD* HF?*\jƨ}v2J\_RC`rF.?`|G3^,~x@MQn5;DH zm_!tN]~ Ὸ;+ϳMc+Ğ w#w%f*o^O Z1N~*) JB9T_>xwXtۻ?QK[y s[J$F+A#M-o)w;kП ű"(T- G  (B(;/O>A4Q#x{⦑IYhF88k?OKe}g᷋[#UE=xwG^@xh%6xz KMB$r G ?ZQ>X%֝Ήzmm(l۾ JpcyNloY5|qk66ȇ >dla? T'uT4]gLg{kY:H2  nrYw>Zh?{?XUBv y7cDsYܚ߳=_~0'|E7RBqe9*(&הQP (hɿ5\;nn.X~Ҿ;Դ?/,nhKKo"g?&o,뗟fGWRelZQ%3R\ozO,y`i:]w*! L@S1_6x{W4˭?PK[iLs[J$G^U AcO*tk^7# gEWV,?@e 4ۻ ,x◊c]k I5;`By[R5U|,R1^4`NuS=< S`}]Zmo,Ǐ(t:2tT0yۜq,QUUU` |g T~~mWLx5?'Tzf4۫>bw['(F仒df=_oi5%ִ7W]ڥR/+5㟳K>|XGjKhS/T0lCl\( +W x?ZW x?O&"77wNBJm;E -|[^rǟ4?xq`OmbeTXPjՔt#*>.|.~6|*'~ѢLocZh8bA9?e/k0.{޽̊[n8@j:>|v^5#^c4}A`o!ҭ.<3?xMƺ9&e`Tqb7U*cw'.|kg Em #,JS&/losŵF9aa@5cAVWƯ IkeDJ].ĩ Flo ]cO;n [?nj Q Łl)IaJ|:Y VLJEe[@ȧѕ'h GpA<_O_^|UaVMM.4wӯw@:Y|g?|QEƟRCǽ_JT0Z |>xWҧ??LbA]((ȉׄ-Z|}"&^趠__Rm_fAb7uٯP6?V# #x'VxL+حZ4; p XTWFs .GFs .A<3wu?ֿEsEp߳Ƹ?i_ٳ{]>m&tEc,I,;0DI+G?tW&O5ZCIcqwOGkU?a=8_WEPf|g=^臮GY`k=h)1j^Gs_/?"r?o=׾\\?xaZFXqG>՚( .We0M@oc/㏉^0HSgF .u"[-yGrz_qk2[Y8D#+)Gj{V|3N=֞|Yx$jwDq\S\7+ /# U5)~A3;x݀7HF$~f>:\[vR]C]$_eBbGB2V?0ɟ=e9Buk=I+9,\?C'ӕ}kCo¿~O x_IۭyGƿ*̀ɯO9{ } ~v3Ry mD幺Ce}Ll9REI[9?ڷ_njl]uM{Qm#[F"8,)/h^$ּ[+ZmGU{{^>J2}$I5ğhhǫqv< GVEG 0gS( ^l/xyNM5u.ݍ'|Jl~П|>گ> K{)z=h{:OA6,QDboRx .c^47 mhNC+C2_I_9s7{iyJ[#$w3k^dR@`d;G*[75|*4j?Т^.2\.ݻ ]:ޟZXNVӦmF*񺞌#syQOh~0gxgĖQjnjỂE y/5K {aI'rxI$iZI%RU.q^' UM(k8E|J!.q*㮿CͫiS?h;wefR+Jd`? C ߴ5DOMⷾ%~_ [76w;hOs# Aֿ?x.þ#X#Hf0=<ɮQ-9-ặxHb?'T",áW_I_/&߉4zTGX 2IByWFPI O Ok?g b{w=~ϥx@%8V* xu.&[{y)bJ.+сzh#㟅iuk}s(O$l3QYVVRW]_#AF^$?k τx2In!8H l@f/ !xO%\ZzU }]ܷf?* f=9B .ki\$q"Y $#?Y)v7C{p7,WlI+vj7[p?ypTHv/ED?R,O)?)fwx;JdӭW#NU?dF&>*Ϳ 4';<ا}a$<\S~<^x ;'AulZ)uIM:fQGS4#YkgZo| žiecՙI$I{׈φ4V)jL_0Fh:ՋtN" Fdq3_` [ {?PKZH|9!Cv6,$W\ku>0Ҽ-[Sǟ'mt۩׾<)'ju01!v6|E.GG;Mg O}A"GSt_^"~4x>,<#˦jW̌2Vl( sx6tZ>]Ưr@qali$3*7~#W|EPH弒<:{}2K˟b<IjdW>Gτt?xwOMY%=˻}$c噉$Nk4 |GCšƓiVjvY_=$x\ 5OA4e]aώ eYre+~Kh>Z(bi (ޅ:pKb>?i|/jh%kY|IcAuu/x-cSzE29 tf4ִﴽb+;RP::FV}h%QE ( ( ( ( ( ( ( ( (?*O׀׿U$_f@2J_䏛P+(((((((((((((((()9u/=ծGj~_Eѯ=Jo T\E7~85glEzu*B=IS4'Y5IQtش#hp((((((((((((((((((((((((((Jni%j7 41jTǼ_6peq2˧z(Oʥ6⟣:1Z9UO(3((((((((((((((((+ b˯O5N{wV+o_:pƏ+ ( ( 9ி# _W_JweV҆>imέs[\]M8"i‚x?_7_֑^_94m}g*Ok~SKn1A\|M?_7_"_tOM/P6?7_K?%8He:jHYx :];XV8XAEUGW=~3ͿK]{K;R+q *G?!-mt_zfOg_ ӷ5{T>ps4|ѴU~ (O P-g'JOJ>3]h1v+8@ɚSf@+b_%xf4še~u9n?zQ@5^?b_ my5_ }ZZ[RUb9wq##+u޻O A_7vxT7.𠨟g3qao_fŚr3̄[\m_VS'~+ a 宵{$@=8Z=̏;GQ<9i?4?IХX@K?i쏧vHKVyM>䷴vۻz+7POSTQ@fţiEkZ(1J16o"g.~X~:}i/޴(?!j!-֮%|Q\jwI,һ1K1ɯ/4!iƽfZ7$IP2I]X>D 3剁*3 {m&o6>l-*{0iC wZh/<3/U^?wp^gxcŇ͸f',,ǫ{?Ϗ؞Jh Rd5ܜ"8agcqf Ø!~ ڬ1>>qKv}HecQEԿkoƟ Zq ݼ8^'6coi=^Ye;k4o X?g7yƶV|߷%oZ aB(((3c߶»NlKrB1*y=FE~ޟh}}Ͼ'ƊYO k cیG  圚(_YO/ď:?$Z7$f7#ksҸI"Yk*pEo Gǃ.<=o ~*:wP#ukk iى!Fy99aO!ޭJ ]Ԡc_%w[%t |N~*-VKwo7[bw9(lWL濣ٿOokEzĞעmo 4r#aUe#W;{aq_ZZ^ZJ\[h$F*2 =+{ jퟥ3ֵ6gr=6{i:n&n?t |pБ?WWڢo [ǖS}WJq'yrE,_JWO?z:XY:bk ?51{3*լMKT>sZŲ[Tz1<ه+|ER-ͬڦ&pvY  \QA\==x|euIKR!%OrG WyA@υߊ&^GOT/A]Fm=WMM{ O7f+T,+^ک-gƼ_{i qV2)e89=x Wu0?knmdc˞`?$*ѕhJ]/mg@EPAiO$??{5OSإ0SIǏ*z Sh)k? 4( ( xOڵ'"k_?j7蟳_S5?g5^x~5#cfÆ(c__Sm_fG/ǯt)?/?_ux@Ì?k 7!_]?a|o|C+g;||*~ 𿈴xov3A,OFue8=E{ ?;R5Ot++?]'N|!$JҸ4?(0k?D=t|g=^臠E5qOWG#Wǿ?+7 i\SAc EPACt}uc&r׸coۻ +U ނMOz]|uc&r5(mnV'_90s/iP[,QEHFTS z?jkO*mQ.ET6= Yyr}eZ~!֣}MK?E,A_Î]X/kCTfK#w8AQ>BǑQց55ofl>И=w`6pp#(*Ơ`(`Wq|;m(Þ=fqP-69?@1@H( 1_a[ͿPm;=Z45GT ڲE{a[IsN?1xAVu%mNYӮc6$H}+[>/?|=+?hQވO ɰݴGS_s x]M%+3ɝCq,kxzOotm'C,t+tgm kQ"UT_O4yο1@H( s_O1~_Q8egῌsk8ԪêB+}yi N|>YlZd9w( G/?ڇ>7ٵ_ݜgʚdl oiKu&-Z8Tv@WՕg8!x;B }m,W7"W!*~Y?C:q| o(!xR\%լng99' |d'K!;kw]anNOCdj]uxfLt<ۤ@~ {cSg9ڕƍA`dnePX<@~ d.K>H&c#=*9x?^6K%ľeK_v_<@| kg6w ..dX@2]؅QrG_Wk=ӿa/؟;xaU1Z̹̬-*?J_[|'U{{W3enB 2B}7gVQEWTo6 {^ |w$x.^݀s?US?<1p G 2Nr2c#Q#K9' q.>>)?I>Sy,V{O3*=-5~$z>6IQwp=ƢEQ@Q@Q@Q@Q@Q@Q@Q@Q@WREik߿િ/?3MG^_/GߨQEfQEQEQEQEQEQEQEQEQEQEQEQEQEQEQ( }Mp+ of|k6rX|DQ"J O_;|+~}Ӂɶ3X鹺f?_|EkQBH춡9$ǥ}[S|cEi2Xmr@rNOLHlKQ@XT.0wӑb]ӫ8ۑ}Բ &%vhȍJ0##uGEf ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (PE*}Afc鐛KT45Yj O\Ci Mr|TH${*\=?Yqqh6u`p?i~xZncKO_ `!ȰY4 = V#=c,@?nG~^┏6` YG(_7Jۇ SžjYA(>u4iW[>n+8?5 (4PEPEPEPEPEPEPEPEPEPEPEPEPEPEPEP_kW]~sWұ^ȮӃ4eQ_QEQEWu~P5o(j+Sh(5D; ]xo}gEG_U.j+?*: (Q@z.sgSn9lx?Vl4|< sZuĶ@H8>_x_Gd_ºlm)et0k((,٬i$0О@=T; 'ZO↧$yƍ33c*{p&{'5f7Zu}y+q3}rY$4 {x ?0i:~'`[y[9@MƷksKv2ct.0@sW:P)n~d?IХZ;GQ<9i?P8o(s'`jN,x?M_iHQE_CĽB4 w`(raIQ( (5OVgៈa+<+\4;(~;I/?4Rubv!?.2WW=5zۼn$up G?JuڇN~D~Tj,G(m9{F?kھgih$;(fԼ+-#e$=$OXn]BC$ ihxd&gA[r5o7ſ|ASmV2\iz+"2KMPT(Bk?E)~2z+\j{x"idsU'bgko,gy-$UJQm8)+˿Z %v.zgMCqTVֱ$L`Y,q6'Uf3P]%K]jJT.gCkv)\/QAEPE()- č ?lQU}JͣI'ۏzѺъX%v2܎V+?XVմ oVR"GZ|/0+h-lp_x>O IY08O>n˯٠;nAvj<{}6%2IO+V#yֿ4(x.Vm^/bQʭKqP9TP(Es>(hx^$Mtۍ[RFHN&?_9־1|Va:I*۵yT?g+p[wzq-:~ӿ_#jjx\6ЬD>W_w_,Ҿ跚]N;n+,@_Cz_ ɤͣ_~;Ep$_YgIm a_@o.>N|m2eVͥ~^\F?݅,Q76|.V5< zEcIR{lpkM7S)_4dk݋LF?Wk_x27GEB(%GwIn+%GwIn(ɯ(FӿP"77wNB}K_tZUt?fڵƗr]SdΧQ(HA"GȶѓMP7GkwI$犵];"I8O,oSiE֥wYZdi$q"Yk (a֝WVծUg nv=ɕ0ZC FtS|I 2Ƶ,a[E/<I1g|X~~#KvC{.u^v9r<;nlxݴ+08PW(O CӯK?#k6ξL_RZƛ2\Xj;eU;EKAӯK?#k6΂ӭQA'>xWҧ??Lb_+O$??{5OSإ0WC($(+'"k_?j֬ȉׄ-׿?ԿW' Jn^_Rm_fG/ǯt)EPHQEQE?;R5MZwkca3T}>I< &|&_Z*V,me$n,yzWEm̩'堵QXek,eI> B K0 3g?CKWJ>Y~/_L'~oy$- q$Q?]@֟?_f7_HЮkF!1j^GsAr⢊( ">:u_f+_ɩ\m|^*K@( 2> hxZ_XOn1xKskkxM]T2M@h㌫҂~~->5rHP<'c`[^g!m3_^ko P6kǡkУe5+5Ό:VU%%CWT@g?~)6R(s mkx 2~xA%\S!}BWdU Ԋ( (r|?\.n9$mkOj; o "V{ۛW|;t*^0[s chs=S_u m]\[zpM $leW"/y3x'V$mIQTF-elD t>@Hj(Bw _??_ͷj:2FM|~>Y>SPG{nOϯA/'#}[-PCE* }T3HSrWJO,¦Wb ݥ &kTw?LK^F}Tg! ?nK_iY &;nr͎۫+S21]\v2\jSRnRoնϩN0Yz#?"1r.LkW|m$/?/Yw1Ii7JN/TVZVc'َO`i{\D-]+ a6>[|`yOЭ4v|Ǟ  ~hx_kykmܦIl`e`t08ҿ?xs<,xLRPN)-8ӌmNRo].b(ի|=5Wm+ ((((((((((((((O5N{wV+.M?9+X W[~h?C(|((+Sh(5cs]?ߴG [JZ}a7b*_5p|7b*Kp(QE~tڋ?~tɴEHr6sJ+e?_~K}o·n+lN`u=FJ2ڹW["ׇટ 4|7{ -%yèfW>G?*Tqj~,q.#nnC| OUyrZ|yĚo|/PtR/ފd?+:0!#kӿ/~&x_R𧈬݇rGUME^m?O$>^u)l&q\Њf|_ '5{TӴMIo B-lQID@M'j T^Y}`Nk qXkpZ\n:7 } lPp A"/.߃nз>ױ +2;و~ux':ğ>ykvufI'hr{IoO;ĺӴvg p;G="w?{%m-o:1:KryGڜe?I ?<"Dm[בV ;duXH99'ab?2?DR-_GScK_̹8o(s'`jN,x9TU5}A!EP]^5 GkCTuto%||IҨ/Qh4PAO{# 'lZPa7vc ^K 95O F]i(}j3vu<2;q_g )ר|?~>[z+%օz <`Nvyԑ8aܿ'g+M[O4n N&H:eR #\[~P~j^,XWP%w:!;$ *~Â|OgV4kO2PӮ䵺oT2syÝt MZeq4{'ހ?BJhmmieW H,ǀ$+uGMf5-$dUg~Y Y7j)3MOS~ f}k7ATq{g)?VԬ .U00ZXI+}֐|I%ck*Jjpt-d, pp ~gʩ5s!V@ o9oᮍ xoö6^x?A`]Y#_`9<[kvX ?zIrJS@}T+?w^k @V x"u*x*H Fh <O}g kx7\?.}Wz.W&1aYs?n;j|RyZIkmGOy C%e';d75NU ~sx?ZY{ DheqL2Gw0X-?g4ҔӵP:rCNT(d^C( Z?[mc㯆徥i X= h-mus<ᔲO?h~=|]x/Wt ʙv#=ԿeּH s{Y0|P}rFh)?sK+qFUP2I'?\Ѯg:徳U_+'ZRC tq$ "B;~_66ωnEѢ].*E*ñ5g|'x:αJYX۵˱ #@I$w( ʑI#HB#G$_7Һz~Ö^*+T'Q"ğEnqYe _) ?ۻ߂>+Ѿ4~ЖVka"Uw|k+c$p( ( 9/ w?nh~k[Ve7[ݼI$\@Uxx#nk[PkXfhcgD)OAOQ_şi joj7xK%/u}GN`xIi !`ƛ+.Wjq@ ? mhπnmF+Ņcq56GڿǬxwWռ?B6euYbeqۡ_Jx cY|9XM! o"Ff󑘏Ɓ|#o|1KgoI6iVM[ZBC;0elFdC~֟mRk{icçIEq5|oj^5ޱjZ_{BKY w >bx9OYmBj|Rf-uV:rI1d8 Yz!o{|C|a5ςyQ9Ba[ky۹UXԯ2_??aOsjQCCI4  _ %|+OXd[\۷{vD+@>5W[m쉞ve8}:[k:ݹk0HP3Ζ<2pRO`+๾4 |׭ "IgN,@*ȇk**w{t_|HwJR}Ft R,F0AA|)]O&-6X59E =ԇj 1 ҺB"g$z:E3?*įGkк].n~qgbId^BmO??hM>Kf#σ_.w-p>Rg%>?jL+8S u zkj>"KO{͚}/x}F9^++0Tv5;3 #9e%'uxI4'V0Y^B\[8FEl=+o4?xgTMڎv0: EuŰ+E@Pÿx:dFdU;dpW~l_0ٯɯ#ug4yc4 sv?#OM?s/mm* 6( Nk>Y\YvIk .2;۪7=o^|x+?]O:wJ@q;g&GkHW$ rE~J?WU~J?PIFF#i(W?m;E #.*z0Q7N6A^nKpU9_ڕ~Gms*[ន> zME+N5-*>om,J'_4|)}}p iF",p'*? <"_{4mt:lb+K}c sfL | xo <e}Ŷok0$HYnTJ0Si5X.b1I.*] 1:U JINSsk+r7-:/.j9qs-ē\M-dYsr$k 99Cb6lVP𮏩Gws2gs1.`~ko#?M巈 kLr?zmVn9}3@+E>Z [VdDMk'm@!Cڿd̃?f#_Rfߌu46\(Y^[Vp<Z qW ;xr]8= h?vnqC{w(SyK*fg7ejSjP ؀@b3kDn>!~>۴|9֚QeLvwP9=fHW"_?|7I7|aǪxgtfl|HIS. 9VU#+3<{oA#*A_l?ÿgM|ƵgE&Âo,JNaH{u>Yrcr %3C$o"^'Se#+o[|s6}()cLj0:<:=S4_|Ezg5mm#^Id!Gr l.-3 \~]֤[REF0I@.X?\O/񭽩Go labaO7ş5֋kFK 0xhEB7 s4 YnQm;+ {~aX8|xӖ%-i~V5V} p 0Aj12_/Gk,3N<6:Ǿ= GO.:Sҹk_ bU%~St?}uc&rqg_*KAEQA!_v&I[N#мdt~zdn&?$ GgxZg+hz֟ihŬWWQ `E)$nVRA  79 Iow[E~h+kֺ%{}2ľ312nTAIȣ v|iTK"$nm:+}r7#p<$~/;hK%l$l0À:("߳ct^5-.p[kG 3¼ݏA]O86ujE@UCHb&R?}?YK7hiŽZRy[l-!R WL+^]w5mOS\JݽOw\NyjڦJf{WG%kO%_3kgpZݹ6 h8~E$ {TNmO7~oEi>U,e.xao Gm;!痕س3K1W{A' NϺ_=xᯉi4/iM dT*xF]OfE5l~ԿGc ig%|%|s1wb?z)PYwW\">Kooxj{ d=#Sjd* I%%lz2R CO,}gEk_ 2+ > 5$ <[uoh! x?ht|{w7 +'7 kQ ~v;ԥNFn,!HS3y$0oon/ӭ6qFU@+$SJo4K',rjR&F>]{bdOY( (Q@Q@Q@Q@Q@Q@Q@Q@Q@WREik߿િ/?3MG^_/GߨQEfQEQEQEQEQEQEQEQEQEQEQEQEQEQEEOk <[gxoV5={I r 8 eӞ,f+O!MK@cMUa Ǘ2X!NQi׷oOsp(b_#¨$)|{|ตL0ܲt凙q'gUdxk xKVT5”"K5NR]9|I385&n2|j6TwWQZT~Tnɻ;lԽT[ױs:VO]BiZO-ndT,3Mbxռe0b,t{}c'/3Y?pko -W'8L67WU?>X{#}}kϳ.*%TRF8>JqItZDZSd.]_g(CТ((((((((((((((((((((((((#4asޝMz&Uy~/<g\j%։[D2uhIcC R`ߨU $<;.׉KK>3}|*~ܞY5R%TpJ*uR6䓲mtG-&ۻW/Wkx?8Ki}'~:JH5wexѕ>xǞ.<З(+gS ߑm?+ĝ/Eخ<lmlmr93bȲ/h-#0/6 ࿈V|Ey{g޿0DnQ.Ѕ&UA$Zsi)I%HWV9EU_%(B(((((((((((((((M?9+X̺4_'دob.&]oEh](=((? iO>.Gnf=sO|m#߸c1_P#wRU_sOq޽_WP|@M k[CdK61GQҿ_(wg߰?؋CU2ĠI^wx3ZyHN:׫tQExx 7#FçQSUസS/r1|_~?ثy6obu \iCX^EQEG /ğM$uZȵ`.Sd>_'ϋ^'į v X4y, $N!I37~t}>J [;8-^"( =^E>.__Ftt-TE<%c5_`G9 /X p\[2Mç}EQEf&R̻b'h`8  q@(((#5oڳMH7mWbr0H wPǏ4]KyY!|4EqcIvTNĿfI,W ݥ\ %$ sd_P;~0m̰@fX|&grf5KW!Ex/!?,BeT(.b=m<+hiev,q: ڢQEf_%񷆴?xP]~eռCWKE~Xi'cQ< M촰rKy7A sԿ+ g@G%yi'@3.Hֿvw?_ +ǿ)Jf@f@xG῅Mȴ;yLCjp| (2(ff&4_O5{ VW9dEhXNY5Կ)RUK2~g{eǸ݊:;OZįxA6hAvO(ΞZW߄z~J[x`ef%rkP#_(o㍏/',4H4et,[}2 УsɟnG~ў=^qnLH!Z)^?6A(W3||k|I~q+>|]'vI|y~67[Ėr SZVTC:]|Cp5o^hRkk4>\6xs?W۔uXz/$嘖$o<T bsy6QiůV:i17RKx{}URZKo[+v]g_Ɖ)r#A_~c䟳?[#+x/T+Hvc g7va^v- ҿr_ x_*?|pMZTT;w9;k)7&D|lV֧7߷e؃ EKKݗþ5"Z2o& 9Qp-#[|;8ٞ 'Dw{juu2,VҴ3[ȧ!Ԃ }?CS֦~&Hr\D-(v+H&)}~q0J-|;mԧJp޵a.~Wⵞ}o <;IF֪zSc;zOJuw QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQE7U5gB c}ikGОoG|3|K~߾W2eNilLJ4O MԔ#)(E^Ri6ɫ/6iN sQnkW?q?fZ+_etSE(+ww<`;7'?ϘnTzվc1Y4em>[da:A?*I??S".09U?*sJM8,%*k ҷ7Vv_b j]]R;DKx0g>gF`-SB,#`6g-?9sH"L𗆸+ V%HR [Nee|[bp5}^_?}l_v7/XIosG{Y#0'tqUDʱruaџ߱'< $t+x'|W13W~ڷ|Ed3_cdYx2~\~?q|6\/ԔkGE'\&ҦһJN2oG,B*5?k⨢>\(((((((((((((((+ b˯O5N{wV+o_:pƏ+ ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( =?KW-F,?u{c,q,c]N7-AT((((((((((((((((((((((H47x {WREik/tH ( Š((((((((((((((E1KEQEPhFKEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEW'=;{+_kW+4tYEWQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEfE((((((((((((((((((((((gિ/?3MG^^U|io:)?>nB(0(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((O5N{wV+.M?9+X W[~h?C(|(((M?/kQ4.`s$BHWGSYּ` ǏR`,6#4K@Q@Q@Q@WߟQM.j_aӬmQib;,H#'@E~zɿsZqо:>n(4w`dH&B(((oOKyGW6hdiTD\1UU$+v챯 6~"h7#TпѢ qH*/ q@U][.giPj%͵.9u pT@Q@Q@Q@Q@Q@W?/I=~?>$^ b:}Co+'8(+'oKš֥T^rvH2CFXRFUWQEQEQEQEQEQEQEQEQEQEQ_2ch~_L_ Cxú\/lIn#pQ,FF q_ϯJj5sOּIi5\F `  0(ꒊ3(((((Ҁ +L|=[ψ7mVi#@ #;AkͿ뿳OOP[T=wi *zEU}E|]|/‚nG>|ARZtgI  jQEQEQEQEQEQEQEQEQEQE|i"*~)|@{I譤CcsXLUdV\gA#*H#>&S?o.^ ѼY 3Ti{y "*HGs#RP; EP ((((((((~.|dOxƾ"+Qk!hOo?]%pTOG-kf>oֶIfEEf c~FuMWM- ?gJYf9o6] S?pi_7'-#K]QA!En (4QEQEPh?;K]0\M=m-lv&;q$nW,ܓsc -;񷏮4K7]jbܠb3ؑ˺3K`-J//~;OWWiE?v'F <~xoM|467W:e.naT`$Xf4m6Tn+(Š3A8AEf (QFhhQEQFh(@|73LJ#+J/n#|eGP| HҤ¿&WgOZO%f ($(4PE ( (4(E ( ( WwZUZ/_ҊZ/A& ǚF=Ғ5_o>iTPT(Q@Q((uQE ((QFh(@Q(1մ{ qh-`*H X aec()]i?qի3E__;R4W_f/JSWC(((((((((((H47x {WREik/tH ( Š(((((((((((((((((p(jSk\@%e.K \`AwqP MT|+o5x|?QjёZq= ."yJI!b9-0> O G# 쵤2CGm^;Qlʯ_\|nS~?}9-ֽg_ؿs޿?4tEEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPAEZ+:]m-q,HT*g8.svKV /#we/-&BXď'=ă_B50>u%F5 |ck[|%fӡ~2 ߋn?~Gj oMZmQsnQ$'^\Ca`j)Ӈ8ʑdW0֞տ >Hr(H((((((((((((((((((+ b˯O5N{wV+o_:pƏ+ ( (>Q!hOo?]%pBП&!_ K ܏ï'Zo_O[赭 ?/'<'ֶq"mRa/!i%l7(€+oأ [+W+xZO;x#-+ 59???ǂ4hZOFPA6|پc 팒3_GgxTK 4l-u_ iPi`"< p{\jҿgX5 uMBKx_ѓƪ.}`-F ~"h*ƩgxsvPZfjἷ"FR5k~_֞2S)y{ס6.i"-|Lr8~_M? u+/tn1Y_oU[@?#=7_K!Yy# [ֺ\ڌ\Nr:b1 ~S gg"/7W