,Photoshop 3.08BIM,,Ghttp://ns.adobe.com/xap/1.0/ image/jpeg Imprimir 2016-08-02T08:55:08+02:00 2016-08-02T06:55:11Z 2016-08-02T08:55:08+02:00 Adobe Illustrator CC 2015 (Windows) 256 76 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgATAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FWJ+a/zS8l+WGaH UL4S3q9bG2HqzV8GAIVD/rsMrlliHZ6PsjUajeEfT3nYft+DzjUv+cm0DsumaEWT9mW5n4k/ONFb /ieUnUHoHf4vZI/x5PkP0/sQC/8AOTWs8hy0S2K9wJXBp86HI/mJNx9k8f8APPyDKfLP/ORPl3U7 qCz1LT59OnndY0dGFxFyY0FSAjjc/wAhywagdQ67V+zGXHEyhISA+B/Hxes5kPMOxVg/5o/mbY+T NNCRhbjW7pT9StSdlHT1ZabhAeg/aOw7kVZcnD73cdkdky1c99sY5n9A8/ueM/lfo/nbzb57g8xt czrHbzie+1V68WCmpgTop5D4eA2C9qZjY4mUres7Xz6fTaY4qG4oR/T+3vfT2Zz527FXYq7FXYq7 FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXEgAkmgG5JxV8+/mr+eN3dTT6J5VmMFmhMd zqkZpJKRsVgYfZT/AChue1B1xMma9g9x2P7PRiBkzi5dI93v8/J5BY2Go6nera2UEt5eTH4YolaS RidyaCp+eUPU5MkMcbkRGIelaL/zjr52vYllv5rXTFYV9KRzLKPCqxgp/wAPlowSLz+f2o08DURK f2D7f1Jrdf8AOMutLGTa63bSyU2WWKSIV+amX9WSOnLjQ9rMd+qEh8Qf1MRu/wAsPOflfXdOl1Kx L2Yu4P8ATbc+rD/eL9ojdP8AZgZVOBjzdpDtfT6jHIQl6uE7HY8vt+D6wzYPmaWeZb3W7PR55tD0 /wDSeqU421sZI4k5H9t2kZBxXqQDU/jkZk1tzcjS48csgGSXBDqaJ+55P5Y/JLV9a1aTzD+YdwZr uZ+Z05HDFqdBLJGeKoOyRnp3HTMeOEk3J6bV9v48UBi0gqI/i/UD95ey2dnaWVrFaWcKW9rCoSKC JQiKo7Ko2GZIFPKTySnIykbJVsLB2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2Ku xV2KvIv+cgfPkulaVF5bsJCl7qaF7x1NClrUrx/56sCPkD45j559HqPZrs4ZZnNIemHL+t+x4L5a 8u6l5i1q20jTk53Ny1OR+yiDdpHPZVG5zFAJNB7XV6qGDGck+Q/FPrLyN5A0Lyfpi21hEHu3UfXL 9wPVmbruf2Vr0UbD575nY8Yi+ZdodpZdVO5H09B0H4707u9TsbQ0mlAf+Qbt9wzC1naun022SXq7 uZ/HvcXFp5z5BDf4gtuPP0J/T/35wHGnzrmB/ojxVxeHl4e/h2+9u/JS5XG/ei7S/s7tT6EgYj7S HYj6Dmy0faODUj93K/Lr8mjJhnDmERmc1JN5l85eWfLUAm1q/jtOYrHEavK/+pGgZz86UyEpiPNy 9Joc2oNY4mX3fNj3/K2rN4Gurby15gurMCouorEemy/zLykUkfRkBmHcXO/kWQPCcuES7jP9jtF/ Or8vtVuBbfX2sLljxEV8hh3rShf4ox9LYxzxK6jsHVYxfDxD+jv+1nQIIBBqDuCMudMwrWvzd8o6 NqN1p96LsT2jFZmS3dkBAqSHG1MolqIg07fT9iZ8sBKPDUv6STp/zkL5BkmWJEvmZ2Cr+5UAkmg6 yDB+Zj3Fyj7M6oCzw/P9jLPNvn3yv5UhR9ZvBFLKKw2sYMkzgdwi9B7tQe+WzyCPN1mi7Nzak1jF jv6MQs/+civy/uLkQypfWiE0+sTQoUHz9KSV/wDhcr/MRdpk9l9VEWOGXkD+sB6PDqenTaeupRXM T6e0frC7Dr6Xp0rz51pSnfLuIVboZYpifAQeK6rrbz3Vf+chPy/sLpreI3eoBagz2kSGOo8DK8RP zAplJ1EXe4fZnVTjZ4Y+87/YCnfk/wDNbyd5ruPqmnXDw35Uutncp6cjACp4kFkangGrkoZRLZw9 d2NqNMOKYuPeNx+tmGWuqQup6ppul2Ul7qNzHaWkW8k0rBVFegqe57DAZAc2zFhnklwwBlI9zD4v zf0C9dxommatrkaEq0+n2bPGCBX7UrRZV446Al2suxMsB+8ljx+Upb/ZaGi/PTyUl6bLVIr/AEW5 Bo0eoWzRstenJYzKR9Ix8eNth9ntQY8UDDIP6Mv10zrTtT07U7RLzT7mO7tZd0nhYOh+kdxlokDy dNlxTxy4Zgxl5pd5p83aT5Zs4rvUxMYppPST0I2lblxLbhe1FyM8gjzb9Hop6iRjCrAvc0w+5/5y C8gQPwb66z/tKLfiR3FQ7L1yr8xHzdrD2a1Ut/T82V+VvO2h+ZdEl1qyZ4NPhd45ZLoLFx9NQzMf iYBQG6k5ZDIJC3WazQZNPkGOW8j3b82Jan/zkJ+X9leNbRfXL5UPE3FtEhiqNjQyyRMR7gZA6iLt MXszqpxs8MfInf7AWZ+VfN+g+adO+v6NcetCrcJUYFZI368XQ7j9RyyExLk6nWaLLp58OQUfvb8y eb/Lflq2W41q+jtFevpoatI9OvCNQzt9AxlMR5o0uizag1jiZfjvY4PzbsZYGurPy5r97ZAchdwW NY2U91LyISPoyAzA9C5/8iyB4ZZMUZdxnv8Ac7Rvzs/L/U7kWr3r6dcluPpX0ZhowNCGf4o1+lsY 54lOfsDVYxxcPEP6Jv8AazpWVlDKQysKqw3BB7jLnSkU+PPzL119b89axfE1jFw0EHh6UH7pKfMJ X6c105WSX1XsnT+DpoR8rPvO72H/AJxw8rxW2h3fmOVAbm/kNvbOeqwRH4qf68nX/VGZGnj1eV9q dYZZBiHKO595/Z9707XtVa0jEMJpPIK8v5V8fpzS+0Ha500BCH95L7B3/qdDo9PxmzyCQaVELjU4 Vk+MMxZq714gtv8AdnGdj4hn1kBPezZvrQJ/Q7PUy4cZIZPrNzJbadI8f2zRQfDltXPQO29VLBpZ Sjz5e63T6XGJ5ACxC3nlgmWWI8XQ1BzzHTaieGYnA1IO9nASFFnaNyRWpTkAafPPYccuKIPeHmyK NPjbzZrWs3nna/1G8LNqMd43COQcvT9KQiOIKaiicQKZgSN7l9W0Wnxw08YR+kx+8bl9i2css1pB LMnpyyRq8kf8rMoJX6DmxibD5VMASIHJ8pfnbFHF+Z+trGgRS1uxCig5PaxMx27liScwso9RfS+w CTo4X5/7ovdvyOuri4/LTSjO5kMZniQtuQiTOFX5KNh7ZkYPpeM9oYCOsnXl9yf+ff8AlBfMf/bL vf8AqHfLJ/SXC7N/xnH/AF4/7oPjW3l9G4impy9N1fj0rxNaZri+ryjYIfWP5feVCsP+KtdiWfzR rFLmeZxU28bisVvFWvAIlAab/dmbih/EeZfMu09ZZ8DEaww2956yPfZeO/8AOROmafZedraS0jSG S7skmuURQtXEsiczTuwWn0ZRnFSer9mMs56ciRvhlQ+Q2b/Ju01fzSX8q3dw/wDhS0f6/f26kqZC aKkHIGoR3+Mr7HvgxxMjXRHbs8em/fxH76XpB7vP3jk9x85eXtGk8h6vpy2cMVpFZTvBEkaqsbxx FkdABQFSAcyckRwl47Q6nINTCdky4h8d3yX5cv59P1/Tb6Bis1tcwyIQabq4NPp6ZhXW76dqsYni lE8jEvtrNk+QvnD/AJyP1TVJfNlrpsrMum29sktvFuEaSQsHk9ztx9qe5zCzk8T33sthgMBmPrMq P6nqH5FXt3dflvp4uIygt3mhgfiFDxrISGFOtCStfbL8B9LzntDjjHVyrrRPvphH/OT6IH8tuFHM i9Bam5A9Cgr7VOV6jo7j2RP97/m/75R/5xkvbn69rllzJtjFDMIyTQSBivID3B3+Qwac70z9rMY4 YS62Q98zLeJfJ/54/wDk0da/6Nf+oSHMHN9RfTPZ/wDxKH+d/uiyD8p4LrzZpUPkurw6HbXEmpa9 KpKmZDwWC2UjcBmUlvw6Y4wZenpzcHtmUdNM6jnkIEYeXO5J9+d/5bazdy6TceWtLEun2dubVrS0 QBoyH5A8BuQQeo8N8nmx0dhs4Xs/2rjiJjNKpSN2eqc/kF5I8xeXbTVL3WYGszqHorBaORzpFzJd 1B+H7dADvk8ECNy4vtJ2hizyjHGeLhuz76eJefdZ1i+886peXzOLuC7kjijff0khkIjjCnaigfT9 OY0jZNvXdm4McNNCMfpMR8bG5fXmlTz3GmWdxcR+jcTQRyTREUKOyAstPYmmZ8TYD5dmiIzIBsAl 8v8A57xRR/mXqPpoE5x27txFKsYVqTTucwsv1F9F9nSTo435/e9n/IW6uLj8uLITOZPQmnijLGpC K9Qu/YV2zI059LyftHAR1cq6gF8su7O7O5qzEsxPcnc5hvpAFbPrv8pIY4vy40FUFFNvzI93dmb8 Tmdh+kPl3bUidXkvvW687Nqs1TsvFV+XEZ5p7RTMtZO+lD7A5WjFYg7QP+OtB/s/+INj7O/47j/z v9zJdb/dH4fey2aGOaJopV5RuKMM9Lz4IZYGExcS6OEjE2OaWQ+WrCOUSEvIAahGIp9NAM0GD2X0 0JiRMpV0NV9zly18yK2CbZ0jhPM/PP5h/lh5c1hpbjT7fU/MsBFWgt4mmjcdOdww+Aj2JI8Mx55I g8rL0PZ/Zmsz46EjDEe8mj/mr9M86fmtr0C3WmeVLbT7OUBoZdRuWqynvwVUelN/s/fiMkzyDHNo NFhPDPLKUv6MfwHhX5qvrT+fdUbW44ItTPofWI7RmaEf6PHw4l/i+xSte+Y+S735vZ9jDGNLDwyT Der5/UXvv5Df+Sz07/jLc/8AJ98ysH0vE+0f+OS90fuDJPPv/KC+Y/8Atl3v/UO+WT+kuB2b/jOP +vH/AHQfHFkiSXkEbiqPIisPEFgDmuL6rkNRJ8n3IAAKDYDoM2b46+bP+clP+U6sf+2XF/1ET5h6 j6nv/ZX/ABaX9c/7mLJP+cYo0Fn5gkp8bSWylvYLKQPxyWm6uB7Wn1Yx5S/Q9a82f8orrP8AzA3P /JlsvyfSfc8xov76H9aP3vjHTv8AjoW3/GVP+JDNeeT6zl+g+59x5s3x1iP5heYPy+0i0ifzZDbX jCr2llNAlzMx6ExxuDTw5Gg98qySiObtOzNNqssj4BlHvIJA+JYtof5p+afMS+l5L8oA6Zb/ALpb u6mWCFQo2UKoVRQU+FWOVjLI/SHY6jsfDg31Gb1noBZ/HvDA/wA95/Osq6EfM9tY2xpdG0WxeRya +j6gk5+Hw0p75XlMtuJ3Xs7HTjxPBMj9N8Vf0qpMP+cZf+O3rX/MNF/ycOHT/V8Gn2s/u4f1j9z6 DzMeGfJ/54/+TR1r/o1/6hIcwc31F9M9n/8AEof53+6L07/nGexjTyzq1+APUuL0QMe/GCJXX/k+ cu042Jed9rMhOaEe6N/M/sexZkPKuxV5t588/wD5X+XtWMt9YW+qeY4af3NvDJPEyj4fUncfBTw5 ch4ZROcAeVl6Ds7s3WZ4VGRhiPeSAfcOv3NaV55/NLzBAt3pHlS3sbGUAwXGo3JHJT+0EVY3oRv9 mnzwDJM8gubs/RYDw5MplIdIx/tDxH83H15/PN42ux28WpenD6qWjO0IHpLxoX+L7PXMed8Rvm9f 2IMQ0w8Ikws8+fN7h/zj9/5LmD/mJuP+JDMnT/T8Xj/aX/Gz/VD5s8waY+la7qOmuvFrK5lgpv0j cqDv2IGYhFbPoGmzDJijP+dEF9K/kJrceo/l9bWvIGfTJZLaVe9CxlQ/Li9PozLwH00+fe0enOPV GXSYB/QWQeZbJkuRdKKxygBj4MBT8QM4f2p0JhlGYfTPY+8frDToMoMeHqEJoTAatbk+LD71IzW+ z0q1uP4/7kt2sH7o/jqzHPUXQofULxLS1eZuoFEXxY9BmD2jrY6bDLIfh5np+O5tw4jOQDH/AD7r mo6T+X+qapD+6v4rb4CtfgeUiMMPdedcniyZDgEpjhmQLHdbm9n6eGTVRgd4cXzp8teSVtLnzroq 6kRJbTX8AuPVNQ3KUV5k9ietcpjzD6P2gZR08+DmIGvk+zc2L5M+QfzX1e11b8w9avbVxJbmZYUk Xo31eJISR4gmPY5r8krkS+pdjYZYtLCMudX8yT+l77+Q3/ks9O/4y3P/ACffMrB9LxPtH/jkvdH7 gyTz7/ygvmP/ALZd7/1Dvlk/pLgdm/4zj/rx/wB0Hxzp3/HQtv8AjKn/ABIZrjyfVcv0H3PuPNm+ Ovmz/nJT/lOrH/tlxf8AURPmHqPqe/8AZX/Fpf1z/uYsm/5xj/45+v8A/GW3/wCIyZLTcz8HX+1v 14/cf0PWPNn/ACius/8AMDc/8mWy/J9J9zzOi/vof1o/e+MdO/46Ft/xlT/iQzXnk+s5foPufceb N8dfF/nTXr3XfNGpanduWeadxGp6JGpKxoPZVAGa0ys2+taDTRw4Ywj0H29X1b+XMVjF5D0BbEAW 5sYG2oKu6BpCaftFy3L3zOxfSHzTtSUjqcnFz4j+z7HkP/OTOqWk2qaJpsbhrmzinmnUGvEXBjCA +/7onKNRLenqfZPDIQnM8pEAfC/1rf8AnGX/AI7etf8AMNF/ycODT/V8E+1n93D+sfufQeZjwz5P /PH/AMmjrX/Rr/1CQ5g5vqL6Z7P/AOJQ/wA7/dF7B/zjr/5L9/8AmOm/4hHl2n5H3vK+1H+Nf5o/ S9QzIedSDz/rVzovkzWNTtTS5t7ZvQcCvGR/gVqb/ZLVyvLKokud2bgGXUQhLkZbvkvysLe683aQ NRIktp9Qt/rjSmoZHmX1C5PWoJrmFGr3fTdZccE+DmIGvls+082L5I+SPzi1e21X8xdXuLVxJbxv Hbo67gmCNY337/Grb5r8huRL6f2HgOPSQEufP5m/ue3/APOP3/kuYP8AmJuP+JDMnT/T8Xj/AGl/ xs/1Q84/5yH8oSWHmKPzFAn+h6oAlwwGy3Ma8d/Dmigj3ByrPGjfe7/2Y1wniOI/VDl7j+o/oY7+ UPn4eUfMnK6J/RGoAQ34G/Ch/dygf5BO/wDkk5DHPhLndt9m/msPp+uO4/SPi+qwbS9tFZWSe1nQ MjqQyOjCoZSOoPUEZlZcUMsDGQ4oyfNvVCXdIJJP5duYJ1nsXDcDyVH2II9+hzjtR7NZcOQZNNK6 NgHn8+R+NOxhroyjwzCOF9rVOJ08c/5vUXj939ubeOv19V+X9Xfxivx8XHOHD/P29y6HTriadbnU HV2TeKBPsKfHfqcnh7Ny5cgy6oiRj9MB9MfPzKJZ4xjw4xz5nqu8waLaa5ot7pF3UW97E0Tsv2l5 DZlr3U7jN1KNimvTZ5YckckecTb5n1j8ifzD0+9aOzs11G3Dfurq3ljWo7EpIyMp/wA65hnDIdH0 HB7RaWcbkeE9xB/Q9D8v+T/zs1exXTvMuutpmjleE8aGCW9kj6FfVjVjuO7SE+IOWCEzsTs6LU67 s7FLjw4+PJ8RH5H9ST/mX+Q98LmC88m2qyWohSKew5qkgeMcfUUyFQ3MD4t6133rgyYCOTldk+0U aMdQd72P6Nkd+XXkX8147K10jVLx9B8u2k/1gxQPH9blPLn6avEWKoW68j9Bxhjny5Bp7U7R0Rkc kI+JlkK3vhHnv1Zn510j809VfU9O0m40ePQL6BrZBdfWBchJYQktSiMleRbj7Uy6cZHlydVoM+ix 8M5jJ4sTe3Dw7Gx1eVQ/844efIpUlW+0vlGwZay3FKg1/wB8ZR+Xk9JL2p0xFcOT5R/4p7PokX5l rp+qDW5tJfUGi/3DNaCf0lm4vvcc1DceXD7PauZERKjbyeoOj4oeGMnDfqurrb6ft5vNPOf5Qfmj 5v1SLUtVvNGW4hgW2QQPcovBXdxUGFt6yHKpYpS509BoO29FpYGEI5KJvfh/X5I3yT+W35t+TYru LSbzQ2W8ZGm+sNdOaxggU4xJ/NjDFOPKmrtDtXQ6og5Bl9Pdw/rZv55038xtRaWz8uzaXFpN1atB ci+9f1/Uk5q5Qxqy8eBWle9csyRkdhydP2fl0kKllGTjErHDVdO/zePw/wDOOHnyKVJVvtL5RsGW stxSoNf98ZR+Xk9TL2p0xFcOT5R/4p7V5Vi/MdLyY+aZtLktPT/cDThP6nqch9r1VUceNcyIiV7v Jaw6QxHgjJxXvxVy+DyD8xvyI8xnXLrU/LUS31jeSNO1rzSOWJ3JZ1HqFVZan4aGvanc488JB25P U9l+0WLwxDMeGUdr6H5Kvkfyh+fmnW/6MsbkaLpnImt01vMqcjVvTWk7r9AArjCMxyYdoa3szIeO Q8SflxD58gn/AJv/ACIF55bLWF49/wCahN9YutRvG+K6JXi0dST6YGxTr4E9xOWDbbm4Wi9ouDN6 hw4aoRj/AA+fn5sR8ifl3+c2i6jcppsCaOt5H6F1ezvBIqpWvJApkbkO3EZXHHMHZ2naPafZ+WA4 zx8JsAX+x7TPpHm7TPKlnpvl6/hvNXtyqy32rmVxKp5GRiU5vXkRxHYbZk8MgKBeRjnwZM5nliYw PSFbdzyfzP8Akd+ZPmTXLnWtQvdIW8uuHqiKS5VP3caxrQGFj9lB3ymWGRNmnp9J7QaTBjGOEcnD Hv4epv8AnMh8n+R/zj8p6SdL0u70FrYytMTObp25OADuI12+HwyUMc48qcDXdoaDUz45jLdVtw/r em6AuvLpEA19rZ9WHP6y1nz9A/G3Dh6gDfY41r3y6N1u89qTi8Q+FxcHTi5/Z5r9a0m01jSLzS7s E217C8MtOoDilR7jqMZRsUjT5pYsgnHnE2+Z9c/Ib8wNPvXisrRdTtKn0rqGSNKr25RyMrKfHqPf MM4ZB9B0/tHpZxuR4JdxB+8M/wDLflL88dSsk07X9cbStH48JQDBLetH/KssYZhUd2kr7HLIwmRR 5Ok1et7Oxy48WPjn8RH5H9SWfmV+Q10GtbrybbLJDFCsNzYl1WVnT/dwZyqsWH2t+vT2E8BHJyOy vaOO8dQdybB6e79Sv+XnkL82Y7CPRb+8bQPL0c/1iUQvH9ck3BKRvEWKqxG/Ij6RtjDHPlyDDtPt HQmRyRHi5are+EeZt6/5l8u6Z5i0W50jUo+dtcrQkfaRhuroezKdxmTOIkKLy2l1U8GQZIcw+SfO /kfWfKGrvYahGWhYsbO8Ufu54wftL4EV+Je345gSiYmi+n9n9oY9Vj4oc+o7k7/L783/ADD5QC2Z H6Q0atTZSsQY69TC+/D5UI9u+ShkMXD7T7Exar1fTk7/ANYe16L+e/5eajGvr3kmmzmlYbqNhQ/6 8YdKfMjMkZ49Xkc/s7qsZ2jxjyP66KY3n5xfltaxGR9bik8EhWSVj9CKfxw+PFoh2Hq5GuA/GgwX V/8AnIhLzUrXTvLdkyRz3EUUl9dgcuLOFbhEpI+RZvoymeoPR3OD2Y4YGeaXIHYfpP4972zMt5B2 KuxV2KuxV2KsV1vzrc6V588t+V309JbfzIL30b9ZyHiNjB67hoDFQhqgCkmKsqxVjfmfzlDpGr6L oNtEt1ruvySpY2zv6cax28ZlmmlcByFRBsAtWO3iQqjtF1PV7m7vrPU7BbOSzMfpzxSGWK4SRS3O MskZFKcSD3r2oSqm2KuxV2KuxV2KoXTLu5u7Yy3NnJYyCSVPQmaNmKxyMivWNnWkigMN60OKorFW N+d/Nl15Zt9Ouo7FL23vL62sJy05heM3cyxI6KIpQ9ORJBZenvsqyTFWPeffM955W8rX2v29lHfp p8Zmnt5J2tyUX+RhFPVq9iB88VQOm+b/ADHdro1w+jWptNTW3luRbX7zXFrFdxs0MrwtaxckLqUJ 5jud6HFWX4q7FXYqxyDzm83mA6P+gNYjHqvEmpyWyrZMIiQ0nq+pVUqvw8lBbqoIxVkeKuxVL9d8 v6Pr2nSadq1ql1aSdUfqrdmRhRlYeINcjKIIot+n1OTDMTgak8N82/8AOOGqQSPceWLtbu3O62Vy RHMvssn2H+njmNLARy3ex0XtTAisw4T3jl8uf3vONR/LzzzpzlLvQr1abF0heVP+DjDp+OUmJHR3 +LtPTZPpyR+dfegoPKvmi4bjb6PfTN/LHbSsd/kpwAXybpazDHnOI/zgzTyf+S35gXWq2V3cWA0+ 1gmjleS7cIaI4YgRrykrQbVUDJxxSLqNd29pYwlES4pEEbfr5PqLM985dirsVdirsVS/zCNWOgam NGKjVzaTjTi/2frPpt6PKvbnTFXiWiWznzj+U90LG+/SNlaXyeZ7ya2uaJfXFisY+sSFeJkabkGY mtOPI0piqe/lTpfmKObSrzXb2+XzL62op5hsAkpik5yymGW6eRzFwQIn1cxKNmoKryIVTjzzpN7Y /mb5T86+nJNo1hDd2GqmJJJmt1njYwzelGGYoZDxdgPhFCduiql+YOva7rOlT22g2t6NMtL3S31C 8hjnjkubGSd/ri24VVkdESNeRjNWBbt1VYtrtprQ0L8yf0XDc/4bk+qDydBDHcchdC1UXLWiAc1j 9Tuo41rTviqF1TSLi1vvMEVjNrMlnB5WEum1a/Yz60yTBJS1PjnX1AadiQaDiKKpjLD5n1u78sy6 7eXtho03lRQ90I7sSw69zjWZuMbRuLlV/uufKpDUBriqJi0SfUPzh06K/bVV09PLlq89ypubZX1e G7WT9+8BWH1TCvxitO3hiqP8q2Est5NceZzff4ltdYvmmWNZAs1g6ukQkYLxa0WAhkVTx5gD7dRi rH9GTX30PytFfx3f+G4Nc1T/ABHBNHcBvq7vKbD1kI5tb/EvX4fs1xV6B+U0OvRaNq66mJhYtrN8 3l5Ljn6i6UZB9WFJf3gX7XANvxp2pirzbWrfUX0uNNYs72581xebY7q4ljguJCunQ3itG7OilDbL CR6a1pX7IqGoqyGHTdeuvOWsXeqXl7bX8WsW83l/6vHOTNp3CPjCh5rB9Xbk31hSux3Y144qyn86 BJL+Wev2cEUs93eWrw20EEbyu8h3ChYwx7YqkPlCbT9AXTbmyS/udW1y10TTLuzmgvZEt/qhkE0r SSgrCqx3DfDUKGX/ACjiqSeWbbzB9Z1Aagn1uzudK1G4eaW3vbS9heSSOVPrhk/0eZyYwI2Xeinh 8FcVUfy2/S1xH+Xd7pKXzSrZ3T+bLmZZwJoTADbiSSb4JqyMvo0JoOlAGxVDeT9c1W587eV7yWy1 Sz0+5j1aDWYLm3vZHE7sWiS8uCixzMAKrRAEG1cVWaWuoafY2F/Cmp/pJfOJJ5R3pMWitcsrqF40 FuYW5EUodv5RRVvzT5g1g+bjd29hq1qdO812RvJPRvbh20yMLFJJHJEoiS1lB+G3AdnJLYq+gMVd irsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVSnzZ9Y/wzqf1 f+8+rSV6fZ4nnSu1eNaYqkv5Rcv+VdaFx5fU/qkP6P8AU4+r9W9NfS9Th8POnWmKswxV2KuxV//Z xmp.iid:b6f56a20-14cc-6e40-abd0-f72e7fd11355 xmp.did:b6f56a20-14cc-6e40-abd0-f72e7fd11355 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:ff470bc6-f939-440e-8f31-27b0eb70075c xmp.did:4de20fe2-e96f-dd46-b8bd-1606dc72d06f uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:b6f56a20-14cc-6e40-abd0-f72e7fd11355 2016-08-02T08:55:08+02:00 Adobe Illustrator CC 2015 (Windows) / Print Adobe PDF library 10.01 }ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 }ICC_PROFILE E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht}ICC_PROFILE ! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dh}ICC_PROFILEjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<}ICC_PROFILE|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~}ICC_PROFILE !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$C]=].OdnD5LUE+z̽ m9oyv^\UWuDWkUW]b7QU>S~$OVr9Zv+*krd8oNI*\ݰnr r$v%zzw7w! sm68՞ڱflV Txg#QQ"k^eux䊯XQ+ھSB\<$YlM,RM#*/z⥐mir6 e6͙zIW2Y[6Mwz'*ǗS7-Kr'/~ss={sUUSG+Ž%E#\U搜Hׯ08-w˗c5VǽqO%n\{QgeO3$r1HW1F%q~RGwLEuܦ:T{|Q:/ B^b_c9w,űQED{mykߟކ?VHuC$~-Q2{8)!Se-;qxrGk|b|+MWNjI7#d}|G>CirG*D6UFއI:2dOfjx⨵ ]kJq1ki\lFg"/KoU-&o@#1pub!|՗!o^{&ۖ"5ԒhXl71JWզ~WYS zN:\ݺl'|$Nbg$ju47UoUG3ᚪ~Fe=@e1Z2yKpңU$'wOjxIdrXƢTDEUD$>.\MǸ3Veu(͊"Iw3ݒ:m8_]*aycӘy86\Mucv}jҫ*G^hk'{+ңV9^$pWIdcb5a|$lPƞg"|s;x_sSu8R?Y m,K?bIU^>8`9mZ:,EN}wUpμŮI:p$Vv=cb47$?7Q̊(%CV珩z|}wٲ$lDO6O3Mz"*5r_z{[Nu\UyLoCYk3Ѭoj}'<:5_WY}[nve]arkZiX*k2;zlXmemČdUk9;\79k;g qW bבֿVhc?r*mݲE6hG^,ny՜ic_aYլOEOW!w-xd屳:3x$N >͍NmTog^2F¹<>t_ *ϳu,L|0ٻeQV:cUOi4>ZW9Q[ow)ܦjucnܟZb|'q{3fVZ5cɠK}\7Zp8+VO7,.S;X.ez%2CZegK!6_c|试6O3,f.9YY,ȣ7m1N tfPj<}_x.e|k2=h1큹M"&W/,LkEZy?YY_+ ,ywʫ"AJ<;wϾ;ٽfWfs#,W|Un#~uue~Cv_x|G,wS~{%4kN6#prZrezMF{Yn:ɀWyY5\v[ so"w.b`vb;e{[[^ TI-<g5WV+;n*Kn轉j$V*'{\VIxWc1VNH-n x2ث&ŹlRUzW![VNSu]pf/:k~AN p<7MI<s"&IbĐՆy^_]l<=zcSt^Ox;#{aGE1t4k+NK2ENTDkZYU՗|68Z'ڿqF-FdXb?X!%b8c VJE=BywSnr!9e/q]XI}"CSkͬQ͘ʬ1Izv1dU`^ ?XYY`UGU# ~"$Z3jpG1ʍ^)SFkW꧵C_ ŗzvے=ܖBǽ1mԙHٞNs|5zuDTbX;kF૲ {[sr^ij=*ȩTEHUr;Mz#efOB ȒoSO v,IdlN^kS"!Vlg`5﷚3&#[:G)b8x#DF1_U<1f6\#^kc)R㫵I;5WY /z_sW=cSs! 4Rс4Sdׯ0$*/~R+՛ }>A~~x?}$ŗ<$$iҪoNҒQN۳sU10E콲?ͯa3y,뽉ҿ'WxrظzL6|r5g檫WalE孏NTDxC艠fNFt>ogm}l+$d7F{XQb6^_J>I-=/V{DzG7˫Hr?~1W{H9dsz$qET~H~aGzߗ[?9F;G\.!N*#?<ՑTzyDl'\^=Ľ51ժYFhUrD?r7-'??+]j3RWuY#'*u2ldl1wgj$._; Ɣ%el^ۺG$cWѬlj#_*9\X3^e.w#ZͅbSc=v+F,H:U۽;NO,,{Sʓ%{L"t=>9=Nk.髰Hۜ63حgg[NUdsaF"'EwU&r `\c9r¶&7,¹窻̎H]<ҹV=JYV3#ܟzƋ/;ebL?G5jw=ޅh,ңbDjtUO2%YEo׽y\j9&_Q[}Q:/NĻ̝|1Dm9Wz꿸̺V=k~iOrG/B_7ebL?bG5jr 6#c!W ˝*9Q[V$F'ET,{9-oi\ORw{7 j9&_w+UGkYBOYzo_?/51]Gt?ȿSp?ßvR?>-Hi!3WX3knc>7Wc7#]^Ÿ.="۫ vx/VWg>L:/vĶ5+߷l7'bt'?Sx:ЁSDD_UEö#dԫ=Z̑|G"'EIo&oӃOc}+ a W+5Y|j<{c\ŁGn{!֮PoۓOHI$;yp_ɯt=vM:XFVXd;}՟z$TD_hUbb>,-^hܹ3Rdk+z29U4ct9zx;'[r<೑'`Z%Kʊ>6.J;F]my$Tګa zث*#U׾*N,;p' FkھDUE:W#|>ӯv_ >HOj=sfsZ^|>NSֵ'teQxM,}ߐy\{M}HJ>%M}'udv,TUWOnJby^U=Zn8w{_'E)$/qվ͒[jJWzqĪ>g*ϢO"(}jC0>=G'uyr{6&+\Qʮj:4]JٲvZˢdt.Y=2^tWč_R(D`|8r]/Nս|Ӫxu+J;Hkq_}=܌f[#mElki+Ikfyahv[>ӷ F;k%lFl?ee"ƒBhƫվ'~,:oӑ}mU??:@5G{\Z9E:J,: mʹ !;ԬEn!ZZ)TmսZ ׹NLGbdDtr<.|RTsUQP***/*xGhb]^kStJ_gZ}Qf2F>z"*1v%rn2ѩџ`#-V*TTLkCs+jz&YIc1Xdbu]Wb;gfcV5N$>˕W͙8Osܿc_? 7uX)f7ǫ>R[2QdQʝQM>>=wk^ڟsd\.)ԭzV=~أ 5dQ2*W֭//cĺg\r̬W9VWfopͲReDmG! j^^*"gT^4dDB -V[ -ݎ$kZWEGdr XQUw~ߪfMhvU>93fk7_ 6iܓ47##\?O2>QG2DDꪤq p|uK/NaGHƭ'YRߒYas#d)#?sz\~W0FUPO1A>|IﵱDZsf^6,ru贶} ;BttyՅ%r~Ow%%ev+||䯲O֭Xl"_2Բ:|p]Iퟰͣ=UtV<]Gc#˲k:'_ܵZj枧vݶZv4}/oi ycz'՞,U'F~8 !;2Uv'ʴ4O]x뒽=ۧo̧?;F^O$/7lrb4Ns'mP}I7xL|/jˢqyȑ:[<}1#W%HrƛqK٭j{(|;E_ ܇dU}itwZbr}E׍St-I~ޭ%o6 XsGΎoq,FuuX]cW"*V3[_39CQqގOg>q3BnBUD^QEHUW/\ wiy_EU|OYW*{' Ɯ\/y2|;$!ƜhĬ)'Kz[a&:yj*jt^W./Ӓ;d;m&FR#%{!cUz1!aXWzOFXR oOadfD^2)TWdbQQ~ |A^7QZd̶uKLk7מ7M**vQ[9g YܹqeSQ'O'SٯDR ˯e를N{_Ვ\5qLthݮ1QT_|bRlfw ,{rxܪJ)gjsU{>Sk湫jQS){~Vk5ױrk,F v|c"G+">{G+q rΥ8$Ev*֚别WbYb|U\+*2!p];V)a)zՖ//J[6*ej5^/LO.㋻Q).Vm7re˛5$7ܔHfTJdJ+h7aݛvˠvW߁&kz}Օ.oi摍=xRGkyސ#tbc)R/*yEgt/ުtODұ@e,GQ\%{cO{֧U<a;͚F# uG'*UbOI+y|'e1L>6r{}Xn߹,5j׍?֧Χ5\#Z\Dj'U^K|.x?;fN:;aAVK s(5WGLRI}廡3-Sȓԋuڡ2W=ݖp>>P形oڗPw(\-*M^=bղvG'O/oei'zuN{e^7!E!(=Z=_FZ|T_VObܟކ6n;Arn{0uxE<ّ^F9؟ڽ =QE2j*:TW!탵t>q.lWfsY4}OnEدīTN Z^IYz~ED_%Nc7י6awT&24jWlV$jS1c]rWW[$-;}aљ]8®ft9c{,ξ=:}-KknojHdWZկm5V9UD-lY]QeJ+O$kܟz@2,>Yid_3GUsTayǴ3.×yl'w3sZYe23ٽvÚE|sfx]1푯{1Ϡޓ(Ekmf式|G^Bho;^ᖷ'鵱{"Rk6dziߐVrPeǯN]/_Jm<:M5>{5Mpz$ym,)ToOΉo萿(v+{bc;;|nJV5c=y2FA_V$hLF+}u<_qO}eN37 k]-Z](uEjʪjn%pMU;Id1IÆ54 ẕWųtGmB>gd}w/s7͞қoۦ.]UI'%j$kccjZ.;Œx˔؍ghɵkvsK%=_z1z/QOBV3uVD 5#>*Dv[-cerFk$H#XƧWK4TkW9ʈ7+;߰kļk7mY\9Qr͋9*xu84pA֬m8pnf1z7ع2؎lU(PdeHԩVdZx,قX#b&+DORy4I*ai=c(իr5U3~Vߢ_j3Wny sڿ2Ux8tlrw$GNج(lԾ%G=UQԇdxCWHJ6ڿE__QRxnQg3SeuD,槂| js;4ZJym[+ ^,,cq s' iUZ~7UWc/^*x}V>k,Lj+ޭk\]qZ>ֳ;hћ%frS6,~>vYW}frQU9"IdQ1I#cUrDDD6bd%ک#)BL}Wj,OOV/пMr_,rӱczʼn<ȤmM PuLRFI%*؝1y\Ww_8h:GqyQ֯,QIT_}Z: }ޙ3ײ3 KZ/1kݮ|(d)Kvz"H׵|QPcry,.B[cGnKnz9 6r>4U+DױsWSV9r/TsUQQ~*x?[ccfj3-\V~~Qȟ'Y\~B}|Nݡˇxg] <}J-_26_v(oy V?nF֫xy}Fmˌ*95~6bJdl/b[XV,AKgQYW֗fJX>9gztjΞl9]}1>g/^ 2; vyZjv̼#b۽ڲ~ūa&t n*0"ldyڷ'*ҷv¼ -k,kڛHV)yUܨOe"EuO1F_Dj̹S!U<ӱusN-^:U=q>? Y{n8_&u9 סעMVe"d#ܿ\ݪS޸{Pӯh6#h,-iaۊZIkʬuk"EPXi-y5V_m:Y,MY,ҥ Y"68؝Uz"+/ZW9ʈh8yϚ̬IMK\ak>YvVVNE`-vflO\m4͊zLEȍ,nO#jk嫄3%ݫR;/7hDXa_^ "'OVX ,Ce<859nܙz#N4TGbWt *5:|Ti5;)rn'#hW7=Æ4;y,U2?2$qyvw5w]XM 3}vPD40ض|/ZֱxrX籞ec5)ٽ;kՉ#[~|U| 2hսgG`2Cv;:=O4puz|WʝX}}x;WF}-y]ʴ\-3nOz|1O!2MU$HdH[4̫_Яҟ =9?w%?aYCv娩(ZҸµ[s.^{1$ V G5I}"pU~WtD&@Ȁ39.Unfu1Z2_*Vׅ<ّ:6Xo nL߃Ge;ZMZ^zڷlMZ8zW+WDHzc;^%#5wUffd>mY8+W1mVTֵr(⁞=G"+|xȊٻbvDeQT>19b;T0JQsZWo[3 SEӸ%c\2Z ?G5lf'F}IqwW˔ջ+܅+AgJIHo`xr a7dn*:QH6;˱v.y=ۙp6ۧq}f>09Q"~+];*ZUBpIVSU"[dfr;M[Zj&|JE䕭_$ѯף=y7\O5rGo:ڲ*clXf7f&aFK5f s5vU߸/~*۪}v [Wz9fm&EsZwbRf9͒75ʋدjIZFo^3<߬P~"ܲnkݟrAh{x}ٍ*ם%&alٵѩ[k}ODǑd<Ü/jRXt-7lbɮTwc)>&G{׿^qu5Kn>\mEkyVﵛ9W^'Fy+FrkkYK9JRIk٬|o'cj/2"}bk" r\}[n؊J>{'zG1Fgw"!_% ʼk䶭tڲU+C)Z{!<\*1繭XSz޴1Ӷ^B- ivmql \d.Xsccos֢QYc7+q^Q֢uUUR7.n]JәV^ޑm'8&ʪjhUTco9b^6$+1OR/Vk6Rsy<`jL$;o~|cBeLhs5,!>Z+jeYv348tV_<ϔiV(щg'M*}U+ _* u*5N%n+>}kn67<='̮TVB|8ϮC^ϭZsO&ؔ=J'M*~x$zmz!+ߔ^DڡX|6|Lo=~'lXjy1iaG%}WDx}nS3զ=JT1z+!Xƥ(&? M1WY"nTImTGH3Z^.}7FpjeWP_u+{񙙙P d"nWw7j3Sq8xjUs;Vo%}nU9Y߷HyimelFJ+F>Fԭ^7 CjDE译JY\:~x"|ȄJWIV|[e5Jk^W1] (,''Ub:y܍r3MQvWҳ1d5+Ȼg1)m)n:jҹb/ys]V٦>=v.MXvB3RS=el\*$bOϿg݆1ʝ[}9,M:j|SnֶٛMjYJ5<Ƚ:LQȦ 7sƴ{_Чr֫G^|Ez:;]ӮA'g%\L{{4Ѫp&3 Tn7򶤻jz{K7'D VI\y>DOyrfܶ{nsu.jI/_}ȬYl1DCKNKm%f&Gk޶<ӟ^owfmQV\ϣZD ċ,4d{'ʫ>d,*ooy;.  wc:{w JM?+L_b*f:[4U։X3PUϒGQcUTwM-7iNDp:F`rFmJxMsY0忖傖;Y1UU!l4=c?nF긋e߭`\2EVUbsFO$dL|=WTkZ֧Us| &.N\~3$k5%OeGE&Rh妪\azyS9< 1z^NW8Fw5?Xy:3k5nk8KLjvȨ.ehzN] 8l1l:7|ܪI"ZL{MWS5ըq͎sJ̡tVD|j*|`! <豸V2g_gT^uOzOTBw_K6x׉EOޟ_eIDkQ֢#Z̆zRիV֭^&A^xءbkccj5j#ZDDd 0ֆ*⊽zG C"bb2(Glj#Z:x''"|r7 wR̔5\9Tj[ֺxtR>HowDcWNB;/ӋHnݯ9jyg!R?b}+:H}8d+q4{}v*).YTMYisݧb湦A#\|iw% 5 }E:Ox z:t۝#O,?|\"|S9̧ %sbukj>f1${WŲ! ݧpg㰽G!UygWwE_x*ʭ|8Z߾[e1v~=vnj<5>:*>: d+ԒR5H%۱掃=%e8z*|$E6--sjWbįy^+G:IUUT/uNI"Fm9 r>NױlyR|{b[&FkI#'U1vxrvg `&G=9ty,|i^tR{+$|=zr_9UU~!s> 1_F˿_]_f8Σ^}ғ~34񘊂3=2#@y ,KM4lqEmW$=QciuY7M`zFѲdaus_қ#g3x^>ر<U<`jx,Ѵfqz36 -ܞW+,}8,JGlW9QT{\c{ܨֵN*DDDR[d۬. $u%_3o'^m8ްƾ*M򵚲"3GZo{Ywsҿ'crm>%m{x]Okx[-ddbKIJ/_׭_~OvP2:Esǎl26 U4<-i/bXJczժ6n_=U>WWǢ$1Y1!@&ĹbaZ"_mr>-wf'w$ʊ"HOSXݠv+_w3x);'U"Yi]u]~WzMD>{ țT78#ω'՟< O"f-: 4]\4/yfZעgJR/Ew_ߗ~+X0:x'Io\{jʵ"UTjycgUl_M>(Q~?u,ˠ'̿!UHdJam\>9fiՍ<ϻ~XP Z/V;7v&+z:87ʋ_o/ml|=o5|e9SRx'W#S*zJ\N>+q ]vͨYpگR>Gk'!moEES 1coȶj+F}ewUȥ9ݽs#jkXnwfW4_HrAr+ro7')sr# rFl9Mhߕ|gsmޱj##jmF1Ƣ&)!|7Lv]wnI{vf?'5ܞJ{7Xw6"5DDYtHdzt9^/r 8 1_F˿_]_f8Σ^}ғ~34񘊂3=2#@>^D+qϒG1{*5kS"~[-byOaqrٜZlv+VC'\1*BfW8bʍESlxV.O',~;Jٻ~/Ju+D%G5*"*W9Qj*ʨUU| 6Uv$G3^TK6f&ruDtxެoȨwQ5F_Cg˘˵Q{C1˯df2fEwx֢5DF:""'"! zׂH!V1WZLz1C 0kZFɮa Uz 6E 0dQE(F:!tOODӘy{l~g-1qtO19̌_(Tsئ*~i.]3]* &.}wn9:wekҎZ2x ;Qn;=7 ܗ?Sl?t5dbݶbl2m)Jg7b07*™}45<-'T_*;$_jmws!5]!Uu*:V:CU:':U|Mp{%^d伽Y.7U_*b8q]͈ 5V։yad2,Wu}w%ަB/J즿|vieH#lφ/yeDWۙҪu74_8<>~r(äUnߡw6]1u > ~WTW9Qj*ʨUU|+ӯ=sVXef͉Yzcy͎a9ʍkQUW4ֆ[%zI4#"bbYeGljT*_OU@W~rK:ι: C! rbt0=kE](wc o%s[cLK=1cT{cvVX뵽g/c.}W'+ڮ-߱K0w!Fe^ҕ$b5GI/o,Mm(Vy6UŬT@E?-?fÐ`5N%n+>}kn67<='̮TVB|8ϮC^ϭZsO&ؔ=J'M*~x$zmz!+ߔ^DڡX|6|Lo=~'lXjy1iaG%}WDx}nS3զ=JT1z+!Xzơ(%&@FŹ:Kz{VUS:Of`ziD|Oڏ.Q!f]9?'UFe||jFK$W j4NoV}m]8﷎>iݴy51țTnKtۥ ܣ#jDK+Rv9XL~22/cR$g^ySN]2!U<fj^I~R:Y_ѩD wߟj~Cwu6]sfGdw^AԮV2M ZyN7{r׬'e5Io]qS#uݧrׅ&MJ*{L˙3 b{k2C_+zwoBۙ3=y|󘳛_L.,?uT~o j_>'>}Dɜ[sjZU YIGr͎hX_W׻g,ƲTGԛדc~[/ u6A!EydjX̝G~/Y -FH1MzHߑOT1EH\ݿCl%h/uuc>}7)7_3H1#3(4|^FI#1{#X5sDkZU|9k5kUsֵs#QAI\˓}[Yz-#"*JUdjӤO4&/_&-㰾Ao E9OIxX=ӑNYgڧY*F2Dzw~;CPm7mw(cj><2gM;*N\cٶ?nP:_⎊7' |ꟃ?ӡ1y<豸V2g_gT^uOzOTBw_K6x׉EOޟ_eIDkQ֢#Z̆zRիV֭^&A^xءbkccj5j#ZDDd 0ֆ*⊽zG C"bb2(Glj#Z:x''"|rN/b5Y}Z1ic wWJz/z}%gTUGW^-8"=N=9?x"&-Y+9՚2Vljb%yfv5ons8e6R.#,>fnAyb|2K fj4yl<@Vg5zv~Lj׭?5dTHT D-UkUU5w{ޏs]g{坓++ԟ/;+`5L*%PemMI#}x!tt#Ir]w9{C iR >Y_48 O_0ުʴ5{#tv=,|̍Ѭb}D}7)7_3H1#3(4i,jťZ诇5ղci~:ו.EUw_N9d5n軅26j,$tt]ɚ;#1_zW#{)r&366ZN*QO2k2^WRϤj^lIc_'Ue _΂''ߜ/ȞzAሹ5N%n+>}kn67<='̮TVB|8ϮC^ϭZsO&ؔ=J'M*~x$zmz!+ߔ^DڡX|6|Lo=~'lXjy1iaG%}WDx}nS3զ=JT1z+!Xzơ(%&@FŹ:Kz{VUS:Of`ziD|Oڏ.Q!f]9?'UFe||jFK$W j4NoV}m]8﷎>iݴy51țTnKtۥ ܣ#jDK+Rv9XL~22/cR$g^ySN]2!U8lXٵ4UylP\$1DꪫoqܵٽerWӯ,ҽ|썎G5cU{ֵ^R#sl %Z+q[-txQ%w|]}v=0 օ/uݤ0'#Vs$w.CS-:mð>dLtpZvI]³9MC\87hk_#5GdY~1_j]g6立sŲ[l'ȩ/E~ ~n=9*\UUUUU^*⪪`bŋv'nyZ4,ٱ+btO<9K49\9Ur1Gi-=iGK4J|+ϒYW9UUUz*__UÄ_vo/}#e/A{~\gQ~IZG}ɋEA@L\-kmzńs܏@'fQl'S[īҩK}8#OI["} 3BTe$|/tUtfj}zUWu쓳neW_ 3|WǙ:yg;|sXFgO$˱${e,_ODU~G;K _+^c!vuNvyNiȡg_XUD'nݵvpwmUs+mr=0vu mZ䯯5RLdlUQ}b+¼r;v^L-Lf[v'FY<? Ǥu٫ҩ6uqZr >i_1:Oʿ#Z:DB4.὎Ok||Ej{LU7|5O3~_2$(~#^ vº>zܗ>Tujo|]}gsfAZyVF2Ací 0w8suUv.Cth3駰SwDEm[nAWc#a:9'x$T]_ȈFj"5< kׯN*A Zajdׁ &8a6Z֢5DDNMp hb^(ׯp1(a&#"(dqFƢ5x"x"'~(m[絲ƱW ׎k-!g^O9lVurx\6E'UV_5M2t\$ZjBgl'9YuW+ܟwOY`Xۻ\iv2 ֣ov?Onr#q;cTOe=gؽz`Vs>IgcS̹ ^V{ӯaQ=Wn^"}iJ/Kn"tTTMǭSXE/HtiH%?uV`(FVF}ӻ!'>j"Y^+QNR}y fWҬ̤qԑ|bw*dY16˱Ax͆. NO^w~D_%'H=s+sUsU\*U_S 9s9ss\9sWIp5N%n+>}kn67<='̮TVB|8ϮC^ϭZsO&ؔ=J'M*~x$zmz!+ߔ^DڡX|6|Lo=~'lXjy1iaG%}WDx}nS3զ=JT1z+!Xzơ(%&@FŹ:Kz{VUS:Of`ziD|Oڏ.Q!f]9?'UFe||jFK$W j4NoV}m]8﷎>iݴy51țTnKtۥ ܣ#jDK+Rv9XL~22/cR$g^ySN]2!U|.ܜ䡍ҷʎH|#?2,;>D\sҏn|;3lP߫]FTl%{*d7=jOnZ,P^>_;'f_8jnܑ<gWGr'䲶Ԣr"$$fS-W3!g'N_|\ hooܳ[Mr9i3)Q\t!wN׍rE{׫ީ5'zwK9 4b}żIIzu>N[jW2J2[O#&,$0ւ s]-<ߟbQ{-pO_Dl@5eH XՑpE-egY:PE WcUWzxPiEg#W##cz5^WZKGY͑4mdoJct::yLW9Qj*c2Y{l^tt'nFŒG2h6TFQ\QUx5?{O{,}<y!_7_?mwڷm\'3SY7z{?7^ML7nl^ŝ%wn2r~ܽ ?uO'S-?uxL{N{>O'7?ǷW]Vo{IU:"+ۊO?5s:mk!Z{WK*!S>Ӱ>ڮ3|GiC˼QS ,|}H0IBYq98% LF/_/G+Djokj6>_#Ϛ.@C9ҳ-zSU#VȭTz~_p<`6os=N7ܱґܖж:TqWVޟ/վ'ޝ:V9:T"*uBMe| 1VK l~Zu4mIRPe檵TT%G[} >.Mc=+qV$lTEZ>4蟀dv e:pϿ,?uTgk`yOU  edF=r*kՖZFK6x׉EOޟ_eIDkQ֢#Z̆zRիV֭^&A^xءbkccj5j#ZDDd 0ֆ*⊽zG C"bb2(Glj#Z:x''"|r% &+E"o7f'.7_3-[VJ7_Hoέw筏o94{H|۱ݾW"\ɽϏ9j+:0$Ίfx$YN>7Rɒw b,M5 tRrݤ_1bz>W:;99}j}\fuKnF]~oi'OD|+dej݇|xUcV.+E-Oʪ{'nyq;%r>iŚI4z+&hSTuY{)сzy$>kSO<軘o;훛qn-#= aciqtV׵\+gskTzus,).]~ڑdZߑo_`OEG̒ZZT|V9_"g?Fe[\]s~Ms\躜@=7^L1csq^6b;^}sSsֵ=vWĝf\vcsb/Nr*91QYd:uGHh2}.&(Y*N5DDUVܳ3/lL|}Le&*+j҆I:^ bRCI|^TEEDV8GSzu_ZFDDO!z|>rY+#^ֽ:ȩ৛adgqX6gFj5r4e|26X]%KMG5Ur"1zQt5 RGD7>F PVQQ?xgZnߙU]839WNi޻쓔=9/.IfkivěoKr.[G!r&#_#QE$f_jM~wOy|l9K3ՙ'1f6wU{ڎ^N(ө'^}x_ת^f/ʤ7o_mcYD=j_({F~Tl>x+ȼq[j5$IfYȖXՊFgwGLNAlvkĔf]" ܈?r{eVz7O#zt$ uKGˣuveU=#Q>tCyUz|9c~$/ܗ+x˚ݝUz>(4jfz|L#=(>Mm'vGx9')^w+Gȳ]<*H*4wG'6,=dOz^C(W[D_,9 sdꟅb*|/_ZߙnygKKS[n;2o:+ʒl~O# w[Fj6/|=<9iO7/\;|VAl##z ,o|Ϋ/."2Qj;̎wY۝>oW)e\y.Dk*|o8b8-5P׷iU埆ԛbƙqY\W }tG9-VvFҊ\Բ/pvn&c]&ֵDh[Z!"1G\UUS[nd[mٿf{][W.ܵ+nݙY3${r,UUUUUUUUUztαM}sۊz?rd,D}|[*Oj,I+Ex>3뼱A헳rVgSɳv%&OxEҳi` t3_ ):ޛ^}.6npGmV +9$Om_[/>yDZthnh_U[iEoҕ> ^/FV`u )G I#nN޸Օj>EꪨΫkSٹ/gޚ|QxF ~YAOc~C&_#$ڸ|r#hӫՆx=v5Wbx;㏩qZewm;Mbr&~U6kw(66ԭ]V;ԉקG})eT䓧W}'̈Dwrw aCE‘]-ƮW/UȨ5Ȩ֢rtoDG9 H+[aWGoxZٟ125?S~گhtA#)SZ+W WoROzqXL,XnBswIc{R:$09#'7Qb'fI ըwGv3qy[ OQR4_>W/|?d3 YL.^"(↖>1qZ99GQ9 RLðdj,V :x.&q֥JqUV&C Ԕlny,X+{DOjx"'!HgtMe;brXҥ.ZXkʞ*s vCki+ C(_3%Vu/,ڕ -XH^m~n6x/>BuXw6=+ Wþsu|WGN͛*ΞX籮W-jW'+X>۵9v,5Q|_O  m$1FO2'_Tcς_q3wy)ƝkV|ȭrSw5) J/3U^1_w}3 d4^Yڲ _`8QI찙HOH9UM"Wtu댏Y}絓֯kn pW7 ̜fGd>O5i:(dK.1|P~m;fXsCG[#\_4.UWޗBM+{~˛?'e笝O:ΣeN3kڮUEUzuUMWYUU'z~Ӗn{RLZTTXk7XkXߓB^qGQ;UеLc|cKױbZӣk:GS'.Zizνk壁UژMjkQx"#dmFFFƣx֢"TDcBӳeɥUu`JWK^Ӻuꅶ{xg#ޡUȎV3덍sɲ2Fǹ\uu36ۓ;WZ^[Al;KnZ=\ukU_6sQ/J{,^IzWdj+[15~us_^~ 7d3}w3\دr/||3q̍;޽EW$.^fkk٭Zus+W;r/edIY<~7ŕFڎ-GyU5YZ#UȰݽ&]N%D?j}긓ް~ynj<ii=_W*|܈?/Ǵϲ?c13w׳U"-t8wKYGCs,)ܷgnd2)K%MRyY Ix,/$rHU짉oj&ws{^W6uu]f5PC5y_h|R+z5wT,>ꛞvQ[>#!{pZ28McV9cgLs whea2<61ֵέd!vȪ"*x9Xjs\5~Q<>@ .t OYsکb)44ʫ< !ܩci dck=>!][R;DK=ڻ5)l{⿆s[1`K `㭶鏍2 S%G=s7o9zuFsyGo8L>fJJM9zSc~}׽ [ 1u:G{z9ڭr~ VeE-UhI$I&G,t#$W>IW=rw9l٬ɲeŰe29fYkreKؽdXk&+\>W+e2YJg5s+enX2L.d2Y,&zs>YYrTss\*rUꪪ*G/ER:'^8~ Gz/[6pk}̜Ge|R܍Nh㴜$E|}һ۵OAѾY.'ETO7OR2Y+ًrY+2ܽrUʼnz'tkƢ5j#XDDDDCQ:.w1˛;Ys;-l5EqDic18PR AKJV("6Z~v}9sn\e>ntB8lUhcU:*W*GQs5y,ҹ\|U<)tpV))Z[-9U>Rhs'p+x# 6&/J=C={,ko܎H{c`4Wo3 s*L~ky};evp.ZeJs[,Es֢r$H$;dLsܿ_QWZ"خA+^['7V+*#+<:g'mq7>7OHfQtM]z)Wt/TsR)f-ԑK8ֺ?fId&b~k VϻڗM%NH5RY+[_F՟nJwz(yn}YM}zM:TjL9SBkU~I+#\gO쿖2yz=ĩS:8OzSv4N_I |mw{ZŹ%]qX|2ihl@GkYbI<4sq-W|79ifΖH]CЯY^Eگr##*:&Eef*Y3OG"Dj)1:"'"'Ȉ2!{XaQAQa(b6#Yqj"""tBQ1 1(cc(Glj5Ƣ5cQp9u/cQȵd!oD lZXHv٧{k=RsPe ^[*Ccw2I>9B틺*`;jV ˀF3u;~U>׫=~ԷBmֆtO;Q|:HϾT$^>t}[+% WyUțP1?lU G,go-z}w ;o|obg=; ɘI:~>z;#Jcݗ#2;'f͕lýϘm&OeK*kTb/EOaG/OBt.Rd~ej{F'ޣ4MSslEYnBKX5R>hWlGa?7WNB㻟p״hn-J<˩Dₔ.\g.3(Uk1o.Yw=˅ⲵrvv/ȣf^&kƦMhwUED/8_zעL!_:2;b-P/']> ܲϻ׵S=?Shi?V?4%[T'yllؤXWv2,졳u5Ȩ-ezwy#gUTO+'z7=w+ w!B-c{+a0'Q[V|kp۰F&/vlZّ,[xkstN/7"LNnˌt"cEll&1BPYޓX|µ,/%W{q]][%=Ƌ׫EDN+pnyYv,ٖIO.C/$M+Ie«$rt7=^pڹ}x6,ݸ2w)6}b̭֦eby^%G9ʪa|2~˰n[>vm^k)sy%gWfe\{#fIG9HrnbGI-Q|9{5sUsW?tl-d!>OES;:P9ILcbzۖ>OEQEvus_ILcbzۖ>OEQEvus_ILcbzۖ>OEQEvus_ILcbn#\ t[cjߑ(Q~?u,ˠ'̿!UHdJam\>9fiՍ.>ϻ~}`L>/ ;yٲRV{2Rdq\g-[ou*e,|v>+Nn̦3m}y/> ;>b;[y*5oxd'tXB;5[;%:x:W>WDξ+*3+ylڽvgM4_U qѬb}5 @w)s#߹_+{ϞHcwC-W\2*8mde\}" mDμrͼǴ93Vsy׻ٱү'O1#6*p MkIVfE{׫wrR; ={cG5r*9j^t8~_{O)Scr5(ާe׷Ny]H2F9ZTUCv<;xJOJEjv|j[;$k0HIڬ{QQQODTTTEEEEEN ਨJ 5$ *'r{s+*⪿!W«lY}5;"ImWai1{:lj9MXwIȶ+;s[ڧ({7`|]gqF˚֣sC-~f9\ ϕyag_< Od~ΟTmvGOf [:eqkQR>ӪUq5۽q{napd=JbW=9x@ԣ%**yqmmН<=t7+6KW6JlXKrLg yk,oE맏AD7/NQT% RYEΜ!.|O{U3Zs>^@e;|&UcB_B|~' nn3LO?̩*TׅOwEF1||ma?mE,Wl.-,u_{u 0rpb_rŊE5G1Fpu, ?hփd~/WG:.Yywdq~dO&7(sqg q|n7Xtw+m9ˊH\5[6X%z3 LtsX9#>>7 '񎙳r[mrttx,ۙ"E\ZTgCѱ{ܿYERtocs_+ FV|KY_385^Fܦ06Vx`gq?f7y[p2~[bK֤TN1[ lrO<-_!ou>eo;h/![X$R#:MKvՙcc^yf?H\JZ߮] aqXlTbHkFG"+dg"'W\vݷ۷hgsC>71:&*,EAVlŒ_mڶKuF*RA],/=|U<}Y+X|SIϥrŲlA=ŭwI8k0LigSK'g-I*2FGZY)U=RV^@e;|&UcB_B|~'n_-CXej4aYS5,M#jxDO$r]pi]85;.۰$b+ad1U\l&b|v.=ld26]$E<͜kۗo<-=K>wc\{Q[_j8}w=3;ӏ.؊_#Qx,نٰ{;DDz 5&FҾPcW:ڟ:W蟁kQ4zsG7tjߟոT#v ?,uWtr:(lo';"6:0Aԓ+=E;rk/K鮴Cq؝,fr>_iff *Ն9MՑ3k׫b,\?"QjM ޶z^Q}W+]#^ߒWb]d!wNgC>㕋| y;$̭}.f "&ֻ]{N?C.;\"됏DwK/ӭ>k՝fģ]!u1,I֮HV_j9[az+SѿSUޭkuTsQ,_ j*eZF1Wj)>},;*~xޣ]חts/#Mt dN%ss4jNZHɜ\w_'O:gTr}"tOODFZ1cƣX5kZDkZ< ZֱcֱFDkZ֧FNDO#} iDx/3zN[I;U7gF~Ș!|Xix\konqW-_]sTT?תclb+{?8Îr/E#/ھ//{dӮmk]ׯe\?JwyتSc'+q@{nob$jR*~]>u)T׈atK#3Ϳ%{2n1Z]-O*۶^U:uO3Լ'Ϣv\b\ 塥ʝnxh+ٷ!u[l扑H~ ܳӯ۸Qi\AWygmHg։`sݟJf]Y#ks'@m:NW~c/vӤl#amhYM4s}7_ܐ奏_$ve R=;klK8p<KVVCemrn {|ob*_+'h|<]j-tR?|^S5m>K7YL&YGz/dÜ6GaٶlG?濕f濔sz,=U{Uz'^HH++/W9^rC|8԰fs5 w4̺'N^I<+:1<|ЋPu>qe #2&υuhu'Lx㜮esc# Tk%K"HB5~J vnK&nb<}eU]6qtcoDZ}ޫ`ur>KWZgy>vD|7JbJX(+WbGlOOUUsUUUUSg_pvZw qت| #hRbݩ%ʼn$I$vyg<{:&U`4?ӱb5OYÍbĮ{,mXX*ū>i^g Ud0FȢVF֧}U__T0Pcd6*0Ifm<^/Z.r'kJf[Ě~kxKg}Z}ldrkkҩ _bɢY՗|ʺ'hse69kKH gY- Z#fH⍮jOu-mw<Ϳ4q* }E^B'9`9 1ݙ>8[\KS4I&gs5~Աp(bs[ 4Lt+{]]^ A <VZj- JlsRLI==۬wSf5maܶ*orlɯ9[W{j%jt/$><j#ZDkQ""x"" ׯN*A Zajdׁ &8a6Z֢5DDNgp hb^(ׯp1(a&#"(dqFƢ5 <<?NcI\ӱ*H3Ob6AJ*j_3SfPcpF$a¹YؙeMӚhym`8krZC+-dw7R10sHW>x>\[:g40 Og{ Q_3#{61YobP9iS|غ~U R "U:G5k1{kZ9W"xk汍s#Z֢sZ֧UW*8U}9X{ 𨈨߉-N<\~͉?wWO~{J#n}ƒֿ.R kl$9: J/C;ʞSV}1cvNୖ8!/:"OJ.7 a"5IFd8kI2F>GתV3W5(gZeG`=+[Obya^*ۘ44XwuO*B޼>JvJ;dxmr׺ڙw܆2I2|sbl6"_h]NѮB7t}vo8k_ͼ,{v{u+-ld,$:9\ŸrdIY^%I{W=s\ʪ*Lo1ŕg6 )syks2Vܷy\O܆BisGk.ryܦK7\fs7er\nd2y<-^aOjS>Id{UURMsUs9WʽUUWUT<~U|C^U}|VU#r'x|FI:9Sɱth4?Q^6]Kl폷Cǵ\O&`5ϗ~նu=B}fc3M.RS{Op? mdzeo9G{[E| S%ɘhL]g\HLܟnD}楇|Ȟcye*,QVM7YOTw~J2ۧ:vσ-Ձt E}+I g_;,Cj rУ7hˬۿwu8LV*T+cm9Α,~C%R_2G,e+}WݡVh2*/]ztO\ )|]nUXO5l#Yȝk1Q/_c|>kz/_{zTqWgi+ӹNM3C λ"h}D؆;LU }vwV*jtv.ݸ9ZgY:6#彻fNh6QʬԹ+V+W׽ǓQ r*y܋ճȊ~Nj؎fLP$O9a0L)KgzYVӯEVNYoȋ }V$")ŻGv=;hy\}Z2rglY;k˹jkp+͗e8Fivǹwaۤ"c|v2*C/$d` c"y$doHCn{4OutYW*y~QlN#Wm5ɮcފG%F/*9>_'[cSkkamj]pؾ {GWBqη4ϳg-'۱'R~.9b>x: 7oM걹t\yyq)5ZrS{Ֆʞ>?m2'ZcckXƵcQc5ֵkQ:"'!'1q84x]:n7ZXv>,NuzWmk#cQDDD6 RON;R } RFUJXj+@ZƣDDDBj"""""""""tDDDDODCb1o\m*uw^WʝzΉ:'헃/xa[M.]?: V{_m#J>O37;DUNQU%1Oݦu[:*uO<:xo޽m4l^d_΁v| WCc!YaUI#stjÛ.L:5WVQ:uԁ<#m?6ٻ>v,5n{YqɷYX#z*6jyysEku_D>#G&($w͝HIkWZ2M:웮zH#D>4[C=$?xޏӀ>uўG&f&>5jTO*{+R<c zAmI^;֡ewپVY$LJ\<#dW^w?ۯz/w?~w?nN cO^#H_~޹߸۵z|=ܣZj-ӧnקU^O "EF}vk9[ ]\sX\F|*Cv6-m8޾h+NI^3*|W(c=X18mE]`mZfhR,Tv]]$mD$MEQIa|r#ܻrfuT|͡es$ #lC6V{]Uٷ2ظzL6|k7!5Q,29<rz#$iׯ)EĿ臢K-l}:bmҸ-+2ӎ)fp$֢Wy?$VQI$d1}:s.UdoXcON>IGuzj!'^]?zys1z6Fd2'_N m|\^X+P͞$ْj"j#vVk=DEto:O~Ve.+ u S>5ߋ;6{]r6,Vbػy/ı,>]OO#Fĕ܈G XeYM׹vԫ_'~93I.g|JƤ;D9aӭWz}u1u=X9ot{=VUʒ/#3326XקZvHϰ ^K\4&WxnC|թҫ*"b՜pA*yOBOѯq{>nIN8]l5[sGCM!>9!|Vb=1.6`ҳ_m atd{_3gWD^E򣾛z/FG/S֭}ɾOr/⪍_-5EoZoQ9qaA>Ow^ [Zاٷ[NC EY|7_?Oe_3zK\׵5rukTTꊊ\&Y:uەr.CwX;Uj:)YC<25zrSRj۫z)Yr5kUfkȈx\^檢"***/*xGhtdq{\tbLf?3ߘ|<9ؔs,`קL&o^~2;NWMz7~7Q..&_9DJ޶Q/_?Nv >w Px`O4E ~FFzuP i?ׯlxu ⴎ>n9?ѫgRx#stoi;𾽿EWw:O2QUP~͇ Ⱥڮw5ʬw%Ui8 GsB=̪ޝ|Ka^Jy['Rx'tfFCj##xu ,>-?E|X![a_PU#$lڳtj$׫Dڵ_lȝj.Hqܧț\k5{jc"qZկcyWD#ZѱD^#WO3WŕDX'h9}oy%zH?Q+6q}~:L,VgdkoG?6q}~:L׏ޭGZDc&Tg^NUQ|>_da~.F"ƴˑ,ffSʰno?bI#=VYgzL_.BZqyw,k+Yǹ,XL;|"~ݿ :a~Uuwx}]gSӃx~\~̼}>bR}j_/ڐƝ7Z+l=qow%X]4Wq u;Qu9թ7_/J="bwD3TSdȞhds^j|`8(,pI+O<]du<]՟8JmWlJ8l]V#\uFz j1z'DU/3cVjO3j5WOrV*sO9Esֵ>W9Qzr /o^.VNnG3X({U3zK5O?`%;DInSvOfcU;}/sXzv'Ə ߼>WNfnF%3^gnzRFJV4j֯F\2&BU>VJr;cT~:JNק_WE_,9n,|2yY]Wt(|5z*9\JIE\L{ø2Y L֯Ǚz=FyI6?HIVD<9ϏFL:FTH:}N%5f-F U^ha}vLNV-I^[4z!t^Y3[#2ǥ>!\жW[p xŬ[Y#[:9W̍;n¢Igwmy:}FShY}y*_GkuFIZR1芨jIˬz5fQ zӉsS ܛo"/DsQ]TEpb?}şs'p?}8>?SSHr~s?ՎXB٘zt1_7^'/ }2˯{XXb95,>=}eַl*G{gDO*;ǧ}5r-,sbs6eβG+ؼ$n^V<~عÎ ;N<Lޞ>WMM{P2\Zmy{z+/Do^]ST㒫#URO5&&2s󭭋 h\1ɓk7[v]s}vEH4Ob蜭pĬ꿆2c>˜uaQ#٫7~/O'U:y٥ "t||Ĩ=KJG_ xntjNk1v5}jfGM.ZUti9$V,'.W&c;ꬲWcѹwNb>Vw۸bsk$bDe7OzmJ 9k Er"G<Ȫ)Ӫ|Whޯ~ԽD{4nuwڶnZl ղs؊ܳDJZx ~nz}Xe> 5h 1bv /'$YcHHU:H_c'O&Ff&9z_w_"zSVzuVǬOztIҵ^YQg|Ȕur6͋ ]>%#f?FjR^>ߠ[Z&hτl}"_ha\vxP4RXDOJ;D#9&EXG/DY"ErU<<ϭkA>ɰ-HkMPbV7FZUD<{)sN+tpKG4oB".s['5~O2uӓ/rxFvUTEDt:7܇nը|kT|KVI%c;Ϯ{sz&W[a3|krB1>ĕ"dZ G"yUTu^WcEz+]qO/TOf+Sȳ:}^gd8 y{j\!cgs[nO4QQ ݷj?aw5Lvy kMbvFYY36zzķVDwyV(?'TT?QUU:"'ʪ2!4WY8 74= Q_$k#65UUDDN|I$p$HȢYdsYq#ܨ1EUUTDD3uZ\-yr5a~x|s/om㹇 V6hy=ҫ8,Sm>+֗>uB;.Kӷ[+MֿcDzEUe2rΧBl6M~+xX+!;͓j䶲*|װ7TO3kWޞDȍ52t5}:}N%61/HϺ*cεQj*W/>*}O{.ͪqBC ƤF첏+]{fZ1=8'2;EqY#؝9 էCW)$VZ!Uq<~UIU|R7qLW{/"t^"/_x']&Ҷq>IkvSD#lJM/w,|cdV']85Osҿdn6.\,nr:ƮQd*tkZrX_7;6#fH?cȫYEkilgDdS]U訌3FYJ~/ [#$P폔:r3d?U{zÒvގG5Q"V}s ժh=%,6o0V~첶'z62ȞHT"z0qV:$Y 5Ҷ72Ec~XH־7F9:r9Ej*d2|.-G%^ \$BcJܣ~R|2L q6jن;P2׳]C4N*)"⊋<;lϹcSj/UҳtT%7U̜Jڑ֝ɼm+eNws"V/+on-Iɼrؒ]572I`c&,v#r+'G~G'^l׃5!Yc'!{\Sv;|i/|UJ`xMC!${'p5Wg]nzWCj7rO3'2>s|\S3B#vogWXђ9U>Nwn8tӾ`7=p/N{[C?=$?xޏӀ6q}~:L,VgdkoG?6q}~:LsZk'*W?2:#DȤ]7lԂ&}JȩqVw~A^E#z_-C>˸|l"> mz[-ؿė1Q*mUT%wtO誧4ľI bs=~4t$cZ:8w>eo ;AV['n :R|kNowGfh袹&f;W#" yV6eQ/)Jv9z=7_3v[JDׯ{N-/CtUJӽ~Dp%WNrZ*5eIȿ$Vyk>bW+f4 X8l #UE$^ުf9:?cZ{vfRذV~jj^N#U =@{i#'Jdun{kZ{/vn7l͞|j9E?~y A=id6:W NnT%d|jW"/r< ]'֎/_k\׵5rukTTꊊU+Բtd1*(\;RvtSֳxdjkjȥCշVh.R^;12j֪!KڽQUEC(}~ֻr>%l)Wՙk@|ɚ? q &guź^;ːr<g ":GGBYU9 R#IgbC!^kzO7Dc[V5z^k]ѳң=Ypmct>n$\|lcYy V\vM+3g_Ku[~;O80՛KgFWW42)cIWG:Dӣ}Zv_ -q7agGٙ8$ѩ")_Xm,= t J,F~W=Us.r8+=CWCJq{:F9z)$\ϳz؝W388J,֨j} ZޭccWr=zs!zbݙU۵,J#ܳ" ubGLF1"'x9@sX=kX֫*5kS/DF'[שc)\dUl^~RJOjVւ7>I汌j"@M0jZU;UQkc||Q HrL3p5ge!]gߟkg}k!EkcO"?Jܷpf_:le,YjK.z/֩r?}/d#xϸm ծuHMǜug+^Wx>1#~^ q+ܥSɏ 'ﲣU%YťrovۅcLW ni»1/,lU5EuviȯUVƁ6)1mUw!i"ڤ,Ej!fh&K_z]Uv%܇kS4sd\n~WO%Zpʽ:t ,hgsxO?D~f[ jtTTT wݷnVR89BuNy)#trƞG1|Ǿ|~R,MH'|!JʿXo׬Lq?}-OmlIN[Jim1~TQt^]v[n<(4fkv9.x.;g9#-#s|ΫFR1J\7gݮg3x#USjޥ{gKN1ޫ_*">_z*se~ Q Uf#MS[iWoÌp|3SYT1\ƙ^Kg[^OފeԲ:|Oo3|{RLce-Aw཮*x|cꕡi9Q ?)kf?^iRY;=F9 ;8c֣sie-~b,\Hs>g YjE_Z#(>7?}_-m[1L=|LV?Dל~2RuJVZO9_dy/|u*ƹS7j3ʍsUEE,͞{9LuKofjZpn3\4S:73$k_+[Z\}J9۷qWakq>zD{1cXD_"rWEE HPZrEݛ_[I<|rT&[%fex7emYS;v>mOS!ANo993{ײ9Sa)-jݷ5<^P$$߿={zU: CGǾ7#srx9<7']d/bUcmFgnO VZ"7c-C{r>w+ܣbjsl@cժTꊨ~W*Ȩ>|+:D̝|]~UVzpk7;LQѺ?&ΪğQWmK{%rK#U=Uw{N7;'XYtX|ϯam7kwV6TRGGS%Oe~? %V|V#L6*I$y }WuNz:Ze~Tg |V9'_󖇒V͛i<*OX:$v&<>^sJXs Y %,pCux䵓ōdlN_!v.}5yeim{#.Zϲ+r]nFbkMbZNHܾSܭa菒j_xxVV}uLfob2h\6<$lOsruG"*n;d폶g\~Iw5,Y[!o j7 '8^S|̼axllm'ܳH־+,XܾW5۫ij!:+$25UZzz' xF:JXEV+s\W7Ǣ_Wx[_o7q~a墳>*WU2}|з6>ktٙQ1+m9 'vNWNw_#ckG-JVR̴QTkڽ8z78{QzUcע&'q;GD*TnEWآITI6$CGIQ>(_ nUkVGS\*%A*GMmԕ(|8s:69Uzxu_nJTqy\Zt^gR1'd=֣@f1g5EcU~DW9Q>uHͿwph֣S?ʞg7qݚwOj֪z}U9>-Hi!fz]oݤUOWo]6X~8HF,DELv gTk7WZ"GXsIڇ${VVGHlr͍oTG+=ok4ܥ_괿<ʟvvҀ^߫vo/]Nrk#|#b^'NZz}>8.{ɭv 8-g9sY;[Y4aj+2=:#z*~f.xOyv[|ej}@zk+_7TLJ }_4w:1/sB?r/үTsGů$>_^uZk ظV5ѪG%u-*ƎIjUܹ7+FW>4ZȈQ*9Qz'z*31Kk}{Tvjuc&*"6x*^w<)VE_*[_D&igT{? ҡ^{kcwJSY{"u^򪨟2*eBz`tҺ68ϸ{V"rcv&>("1J9UY9y\r}ɥc:#Ǝ_k~D])Wau+Uch[V""R|e7.ص[K+c{Mƻٓ:4׬ω^ͩAvŎWJnY/rbtDG}sw<2}dNgU:}UI,EUTkqV>ys'UR^}cmܳf ld3$cp^>Jt*g $j!Z-VؓaIUbYqȱfG5S޴y@rd+]liZjYryʲ#վ=:u^NسN!7{bu:omG+ݶgWTeco"x25c2x+>Fߨvر콤x[ta{ V?W"Eww^9`<ϩJlwDsM6oQ&BcMN~6U^%fW#oL?udjMf{&?;sǯVҵz*+yk+-oe+fk&7 dkg s-Z<{})ZscNdI*6JN6F|Q:'+9*- ӡӓdfDI٩QL/DtI_]( ;a99c-y^#;mC#j"x[ssN~E]șHscUDET8zrӺ|k/O޼I< 'KsNWu%gc 9W=}^ݔs f^y#yQ\H'|3فu<(ǿd-7Iܩ&o^ЃBиXnܙj\yY^b5]s5.Qj瑽zxr Y&8oऑcr!'sbHqmYgTEuOiO╫Lc=2{v1^H7{H q'\Q*د>*xEOýI,w=js9[%k^ C,z'^Cveo3kdOp,zֹ 5!f1.ZWu;Vӡt3Ip.#{I:h4>R䊴r+GԭJʑ-c#WY`~{(q;{rNFmgZ+ՑJLk,$ p4^ʭn9ItV3ʉ/>PMd+raz;FV^6kQ #$wuG/c^,k{,y.(5b?FLZv&N a;K9y=sO$RRlȻ=^8NOSLz:(Ԋ5C27fEZQ#D< i:`fI19l5zҹb;=Hֽ󢢢 ]wKQܻ 6dY8- GyNC-VeUI!T{\N~%7 ܧ sg*5ԕ%{6twartdkʾxDUG5QUU_5k3)__FSI]fAѪ۵^ו:tZ}?HUz vvzp_4d.bf*it$lxBuT~KJs5{m{wB8~ZPw%lpO_uq4k15E{Wsb*~VDbT:}i"xw#ݮsX%v=\"7!ȉXj}S+>.MN,.t웑CW(,[ ~uD.c(V\ex9e`1N*Ds?y[GkMc8Ks/FAWup{,%' QӬסQ񖕬"~+f"t5NJkۂ+5'iyY<~G,ntr1~*|`w:}GqeJvScNH2xn#/ZI$nnν۴j88Vc {7EٷSʾYawO"=FIӫ^#sUQSb(=_a5YbI|fSG-"V)WlUqù;mw9w5 :JSbLz$m-YDW%wEgPqٟvmz46y#)ɏb vܒtX"3ϻӭQR.:Dt%WŬNQsRyScȮsEYڿUb17͉c'vTٖ٢ʽ%,>ַ jK[4Xs-H~* ui;ALX#\u*/ihG۱FDD)f*̭^VQ! 'VЩ^Cק3ʻo tw_F֯iQ##G'c3=R)mjלM(p.&9Xom,Y\A%cUgFy֏ԧ5Wdwsunr7Xt8jZh$2wrʬ$3kb[ꏻ$L_W]>4lERyHM,zY|9~sz}iwv]e6%"͑7~W9tr[6Zr9UUKfg-jZmɛc=\U\Zd'nUU{z9{s\+zq ,3ZD+$2>)V?zDZ߶h6+hشVk%+5{`lԻ ^Nע/D6-S'kVfts``28Esazu}1f9r|cOEE#l_&o)Xߒ,Ge#z~]c={=_l8pc*tdc 1hAS6#XrVt)_\;O7WPэrvN0ۣ[qV:;sF7Ԫ#V/W+twr'frXoOt}Bha{@=uV1ʄ׹wGU3)."T̵^Um|dsFʮ_e/ĝ3ޔ#(}䌯.6N%ȾQSMbB v)nʪ\2{#ӫ)1|w23|dz?>TW]bW{8Sd'fyRZETB*njXy $+#.UEEDTTTTꊞ("+E<<ɡHF)d"Ȫ $sGb)cs_IڪױTTTUEE=>vk^jg7ǹYm玜jrֱJ1O~Y.8G֪["^CUG:l'a֣,*yLޯiVn}k&r"9eh/*BP|S^ HnU'T$#5*^fbR'_,q?z(1c1<>j9pOoU퍋ȵ"Fz,d<~x{-zŊŚ5EsXn)6]TEZҢ5~_7VTNH"_?Ow 7U^'j|Ȓ|IߤGϷ%%uk_6o#V`,_%<ʲ,F|G5_+p b|^7 lG9|eW+܍Dr;$֮ߙ]DUd_d;}g+(Hc \탥kW[MU_q~jLHKgI]kW-W\M[պՊ\?E+*!n@hf*o|b_i4*ӧA# 7-j͹:K3;NwU~ɼYero tg쳥}UKwʝ(m"}r\i'Y}"X^Evʾb:޽z!,Y$߿H=|~_*CA(qMss湪5UjȨQPRwnCn KKV[9hܝZ)ثn0\f;dխUJk s%V9:**x)6ovLfH\HW^heWZ)ZQg'K7v:-*n`ukgeadVGbjDK֩xӎ{'RY:~ctI2dcj"$y }I>O5hzzL֓V q:7aPay,lr5[[&w5}UR<_qׇ%Z**89V[S_*'Ο##/T`Pe? <1]c~Hey[֪OnS\T<=hSgN9FSbSٸj4 i}ztmy3Օ3r%ӭݤ;"=fC7ļVdOWq\sӢBTwU|L]FHz M#ei]:di9yI:Q g_#?;^Z0:l-}kQxw!T+ETm1F`?o_VrogQ,\ams 8Ri"6o:#r݇HUo_VTס3qy&mdr b/dq=ω~w}گuxfj7֌5u8*9:y[2݂ Xj)wO1pg6g-ԊOi8zx?br6r8W25|^Kif _e+25UZzzF,yKw踌vGV-XubFlN`#':|9`߈'Ճ#;ol=GrO:'gܭSmw-;y5W[(̖ :NoG^?zrqW*qN۾Ox3BF [͟aelA5VU7D'Z|Eh'8t'6TDo{T^䒏\F7_~oO1ImuڞOGUՕQ=~ؿo*sLy/uZG;m/##idTMnՙj M7{~:QfU9d^kbt?ȿEJRok4䏸̪9}{zx$w7TC2*tc wZ+]튾ZY"VM% =@9k#U_4a 8Ia_Wڷ$-B+DjM,uT TF_V8ܥ_괿(ʟvvҀ^߫vo/]2XkYV>h?Y7%+-a89VKX \4\Qʊڱ"5Q:*a9ng{Jz\{܁dm#Q5\3^>U]_ "|Ȳȫkzy9:?{T.EP:.~{kFI){Wph_7~N_,zxzwpFǺq#w/x{v_6~'IkpↇvZֵ$s{Wvl'gy[NU!98'uEBN Kc<47tTOӪ/߮տyr99r94Ȩ?:,{K,Ŀ녰Zv&+5NZIeGIG\Ul+TYsQW+ZH+귘6$p|!kN2ՒetG1dV5\֢qf9zO f 'SPNMz h~_*GQ[Nz妽=P~zNیkxXc[d(k+7J͉"#z!_9nko]2Pś aiA cH Ӣ+fW\oDO:2r#|vNc]3Keu CU~#RyUVr8lk1%F?ȤzejK]wGJHfb9FX|Zy]K9:.JYֹIm*,F*:"ɛɽQ>+D%s{g OP.kM׉($X|1*֪"{w=$Sg;3, tpK22Ctq>3c⨊q;'w[z~CrEssn9]+URV5jt=szO9*{|uie:*UU<r}e,Xjڶ:ݛܧ۱ioα5L7UʽP[ܪeU~UYU_VjK6$cuc^Z*/ENr>/5mee8˚P&>ޥW؅7DR]d7=-Rl~WkrT,{?oK!\7X$2{9kիEOCd=ȿ*+?ȫ됁 vF_u.5F^FI#1{#X5sDkZU|9k5kUsֵs#QA,v~\5I]-UFZs +NkzKw%z]vk9zn 5wdL7y ڲez=1-/`W&^k\ӱ<vB_Wb~Z*G"sCeW1f$T_:M*uP/ӥ|3+~_ib6o>o`we0]qLoSΜ+flE./5.jH^ƿ_ӼNI}OnzJ粞vXykȨɾmXں fEt+umHϙʞoD:zJ,ϱg\ey<9z+}vh#IC;k-_Ջ'.r|6}wb>1.Cb!ruiꪤ5g!zٷbn|V'7D)#LF_#w^OHzG"/r*)R}wݏjYh=!͜q=hx˒vO דݯS&>1PcqxzWӹe˙wAVԶNXثKR{SvYD }2/5J#LvÌ+YwtDcoW}Hc"/_Lr%֏pXcFE${X5>w=ʍj}泘]k=1x *9LV'V>{77:_# W\X>' enWgO<.ےաg_=j}SkQ\Fsfx=Dx/q6/r1_TzIoNz6\k'r.W"k|%R,ٞX=tصHmtl#g#VZz2g+"Ϋ\w]̨Ο{Hq+ݣ~; ~DV}VX-/Yb}tRnܱ6;>'*ʿBܵT&~/RY|U|zcŭouXŜed71kȹK^y:TTOs3uK d_[ 7r}d6+#mz.Fz,E#P2w I]Cȴn:wKy#ze=>zTZק<ʈmNgu.ve:LFgw95{ummj 8GUc|Ӣ"<< xF#UUUUUUUꪾ**K,,$#i^%YYdzGT$i$Y,K,sG\${\ʪT蟇K;FoRת/_4/b1w}~T~0ɬ*xx*>/yLehSo7^1~Vog$qA+tt=[^{ѯ_7^ 9chW2Xsک%ޞe.Ι6E2z'ӡr>!W]##̓*{4_N&E'8D FX4Ft"46r,ⅅuN9kya*dIS~V#ʈ{1O&FWD#w?n:6|<<Κg^?sU~J]~2oT;ZcO훸utn|=OL_qXUk ]z#گo_ߖ9ێs[QʉKpf5*]vW̼YtUgxgӹdz+ L-/7=kWeW[?Gpϗ YukK*qeʕ{#g_/r#]W;Z4_U|HrJ'1oG/}C_u_Gmt>OJkMﳍ=/YZqlr;V3y lmYΓ<5Ϟ[VAsvrx{!z{<{/,*cq6G9Zmk2Q cuEeF1} 'Fj{UZx\ek^x!S+Փ r/G5z|qY\^sO/c-C)_!]|ӻRIY<9OekG5|QTTT}۽WS/KY-̗~x%F't; |aEz~=GgS+}ϒ յ^_|**;\3+śi3/wr]-Wkyu_+&wūr+V;I ܲ^ƼxK=%S5S)`KPd*b>ӲxX.ӫdlNsEUE&_)w5̼m<'7U坳i:5_&{kS{ vU[vuej`d1=C;vüYv,~`2Y <Īʖ7]rԪ*TIscNjKjh|=ƧΫ~Q;jոSSJ9b9{ mov1rMtK0kؖ1]Bz-,K$c"Seh:Ev%D̩Q2'F%J=@Ajer6~L}U2:gAYU^)k}g}7<#?M>"ԍ \4ȨAFԗ!oQ6b(ʱ\h9k(ת6Qfҧ_2.Jн̆|jõ;/v N8Y}z<=wAGE񖩐jH*[i2&3{v˱W3u7_eMׯVR"tb/?v}vwWܵi[67]Fӥl|:b&GN*'􍈪(\,oVLFf5ڽ}W% Os<F/\WQOKڞFfȼKއrN, #s\WVXc4 s9:V5i=UZ>z=5)PUX~f q~.HOH*ΝVvH>ٛNAֱX,،bUV:,@8+9U.2r5z,el|IZDODr}C2ϻ=ʽO~jDvJر؝&WYE20U*+N?V[9[y8 j?gGy[UPOlN^+ =asg5=*Wc#Wcv/ԖI H}Y;ԵSqV}5YۄGJNV&\fe{<9DU芍艎Gs}X_mdJ㞌j֑IhYnё,yIWâtDnl9k%V>=?rU\*UUUU_UR˶,Xb{vիSKb͛k,LI4#$K#s\*RדM5bYgg#\T0w3g679e ֻRf΍r}S|nGcQrȿU8>`0~F&]r5>e âL_Oωb%7pV5 ,],pHVF֯Tj9v=v=IvJy^gըyd2p!r3gfukW5Sݩf*tOy'Oi=_ճկw dʪu*}y$w o-l̩;/{Y/Z|\v$5-r_'1qK~ζܟo_+jP̪7^V;+Wqܯ=r, aof: ӯǣb[Y:6y+;YbZ/sz6V'Dy;apJY(ibxXY}_ezڧp\_Zu&ҽ|k}T*Ҳ?)sy?eV;9O~O9Nlo[Lj:$8U]Am?_6ܷO?]4_ '%FEY[32#c忔Z8z{K6d15W-G9S#Nr"*y{gl0Z?ݹax*Om<|6D)[Ѭn\R8"EF_ ѳ̛ƚvSjܳTxKJrXNVIf̪7Q=*K17O֧N~dO)n6{Zzu/lϳ8ؾ?d]2j퇌}1:1{lEz.Sm*2|oI6k) b5긦w<]svW9o=l;U-5|AcJ3HglT_%/uwebw_ϼ;~SR4q"卶긋R/DH{_*6 zT|Z]wm6ý0=sA1w2W!f'J$lٙdp$z=T11soF}="߻}v]SWo~BY83rKaI!d}2j嫙>(ڊWH&'mo m; N/U~guOꊎDsU"+\QQSQP˪+nګjV^VO^ya sr9j\EEd ن+{G4#%heb>)bIr+\Pz/*|r! y3}+k#k^ʲ9$Tޣ-_ufEl}R ,2yIJ"drqlZY> _^wFr6qs֦>q7^Oi:{v'E X毇k";v$;C쎗\p65h[֋t_ycY3!cz'e-lwqg}/b[=W.S_?i?wK۵`+ӷY~VYeI&I&W+$=ϑUs^To`sns-YͲ݇`3Y[:ܞ[-Bsi$UW*1s[#2,s1rG/޵e2t֯r7efzIe{* {s*W9ʿ*UUS4:yl1AlU}rUlq9}Er~u_CpmC6ߘr ڢ>ܝ\IjimNDIYՋq̽W;j6rC?Ԟܙ%ϋgikboWs9#k5/ۊ/k/BW,ݝʍ'QSs/oa`kܱ=LW'k-+SrYQ ԍeӾDNEH,o;dâD_4NuT|EO14o-2 YFm%YW^r٣>σoQ*E-l~Ejܯs笧~IŸfA+g6{n!؍R9 fBʭ^T}AUO`ޟ:y+~It9s9rr9zrUrd׮dZdr^~mݽvܯ˖|ٵfy${ʪZݻWYz͋nX˖ūvHYbg>YO+{\*UUUUUWU>N?Y!#7#79ǵQr}TSgc9ڎ'9f1wa^dWJK"{^ߙOG`2TX,G ev[v7%BK;4SUlF|okSskEj9ꢧEE&>7WoOl>ȱoHcQ>f/węR؎Quo6=9jusۥ,|ƆN?/Obݻzzcy#zGAR_+o;5y"FD_eO9Y:xukU=ڛ.bDKK;vۢTYVCb,c^q|:JH@j,3Իv%kvۺpVVoeV~PLÝ洜XAԱq~%BMʫξ ~~)䣁ǃ$I~˫ȚSsB<>c?:ogE/*֓oV| {XGbdb}Ip>b5W=^ޫkƩOjs㸯q)ӶZ5>8~Dozd>f"GӑU>(dOw=w[v۷6+҆w2uppJ27luj{j#24jU[R;ԳӪvqI臸UQglCOa~^~(T?Rֿ fRMh G6qlX1f:,gH\rm'/7NL:s-"(oXmΔ.^^c)z3[F7.w&5-ee\q-F潎s#*sUkQZuEOSsױks\VjkTPNӡt"+Yl(KR;v1RDkL}$~).{tv.{S5,cg],3U,qڱ8n,6ҿ^dܗi70oqC-Zȭ]c|m#qcp$퉐շgΊM m+TN^"o9M? T*rk\71zI ftՎD^QQWfhv_]ɸ>OMUqulֱ yz~[H:eczfHxJ4 wmX.f-5wZA o[VGֶ\klFSr9#xeGw+_*bwTs\+LzuE= v f;Udrz>qKȪW|Igx}2=<.'p3fdAʼ)pM ,Չv|ފfϫaݗ'.glI[/DP!2>91JxpچEd]S|{^;#o9QAl=Tm/TDP/k7ޘrww]d8'CYWs-JΑ-|/-|gvt;DnO*fT\f;ݟڇj1^Nͻ;WsM%>3һV2Qu(GT~}ry+dm.T5|LG`4ڏkr(RϬBݺ5SOi6}!S=NIpl5o3EK ]fE=Lvg3pe-xL̨ci_ng KP?3ޓۄ/s< ܟYfxEnoVpyMEv;ޭ_*tVnlG5W'ޢ^=YjXmOMV5U_dG#2cO˲BH}8tPOa:lOK}k=O`qi.dM]%֟4O2uU"j{F7A7yH8\qTXs l51SHWdtN_L;(}(\Fr[>L6ӥ{؛n0"7nW̉̕{X<\ng߲=owRO׹ֵ]ZԲNZLC;˕3W̕زՉѯiʽ>F3dU_ߕO&HF'Hc^DZUkT^dMග./d3X]Q9y|.cr&S!cG!F/G,R>7QZqN1ټ.Vy|E,^J$Sj*XIǵz\׵#EkT_QS*)zǢ~{vVR6jlPW#dlU_{:672;yx]U}wIwW3w>Qouu,=5=ypɰY|HXTY!Yٵ ~LZNU|Hl”W!}ǦٔO+LdR7RHc|z*|퇧r1~Fv5F_;}kۼUGf-WYdkWXJd\οos&af2-qeZZɼkl_ǣ}| @ֽz)3u,7B+ b?񊻼|YoO@<Y|ֿ3~^=o׭|ޯ?|,E"qwҾdpxyIp>KO$I7۫r9|cݳ߱{H LSb/Kr*9X`a =zw֧{B,gkۮC)lld;3H94f}{pc'a@,|UW*ʪUU|UUWUTjŋOnZjilYbWbʼn&ysidrrUUpn i۳|?Ip.S\9G7VMoX,]O$OPՏRڦUHuUjuT z}UF^T?{gx5O٬ÃO׉2Y㡡|1""7VoWDNͧq_.@:< \BO3\>B5kzu}tTN$ f_hCn>߃=7aU n,]oD^7͉+?1[/cF"$q}fg=W5He]We!Kbujv-4;mXXETۻVK5 ~=|:G}dERv. ~ gl#֥JSdYUQ0E"˹Sx=ƞ-KR?46srR^DWQ;~#|N}{пKL?ӳqm1棠{L6y+&jIzyT< <,h{΍tFϽw̎O#KֲD:$%z8FW3?bqSuY=zB6'O;"'URvgm];7Gσyk64> 1N52kXamZXkC5I7T>'^Yb~;v Hrl#P,FXAk\k6ӿc|]|믁51d?  eolqQY2o(y/\հ<9yj=sepI WCembeo"Qמχs#ްeo,dRJdʫd'HދDXj5ӥG?d)/UBc{sDZrªhl+=Z%";;"++_7t[7l2.Y"z!S=cdU? s)mWo_%~z Q3gZbjrw>F:Y%exđF$[|UW :Z|q=2FOosJG#$C*Gz{?"ժwP?זĩĄG{=WSxURM~=v_O^.qWo9 2+߿fW#^#{_>UBGLQ_f\5iɣO\NKsUl$Wp]#9UѷZW_ڲ|GkjZ*EOdt+#>OP}'ha2WO5!Ub^oޑk"/UUu2;"wVtY:bXLZ hӯUUz&GZЪ:x1ٳR_SȾ?*x ?z4-ykl h[ݢQx1:+|e6edc"wXحo6 f{4L$Ԫg4 ɘ7؊^z5Uz54WOh͉_ [-VN^ԩo_oȿ\'2vfGYc'QI>1S7OWCw0j]]59x}UXb @e^F1s+ǢsUQsUZtT_Rk1s^+\"sWEG"8>Oft,GjDbVi+VK#ze#7JȜG;ocqӜ64O+l:vZ{9[oB,猶lnՠniVlFե]cbJϡۥIO9"X^C#⑿|os߼sU ٫ˉXak=2:"*Y5ϕ*Gz'egwۜ]+}kޗԎ=-hq?a(تf V޽ʪ:I"Ls"-ٿģݷ w3G^*I׋˯+WQ=J5W=b~~۱'D/H5>NvNu_T:Ʀ'":rX+tOL=}g}>L4Úy=Vc914^n{(}ԏPzmŽ:..fqyXkZqvcٯ})у}uE+\q,֑իsԥEN^dG}1٬~MݧDU/Ho DW'#R%T󟔹̼bld's'6uB7n-h5XƯO[' /…xG󓒉",LKޙq.qZ˒׷_bβ/NV"m}c~$ս2Sc.y5k٤/fYyWg6stq5avx.-Lq{|A3|_ǏnzpFO㌋?+씝,{_T|IdDzh5jc<ɮNwȩ}%|nm3 m*9fQ_uj}H{>&nGٹ?bo*ڻ&{|[.J&'a .9o:Rʸ&ksoof_o UO,ޘDLe\dlu6$O:++)}'E_$ib4-UHl6ZsyeVh'u~2i#~_bN$_F?Lw+RpYNˎ+s}3ʈawI+؏̝XE訩v7n]/k4<]wVkכ'崋3nvZ1dX$<ImvUn;Wu/tLba,yMkeƶk5;q/9YX|ѧrb'xuO5_ǧ__*phh$BK4=ljI#լcꪪx&ɮsm]WUq9 ɳlJ8=^bj{+frsq80>kg8a{܍ES0+왌^`q3o!Sbq䷐erGR'4=EUr"*.sX=kW9TkZN9z""'ʥ3,+")GՈ:;ei[M"y|>U`mwT˵TK: fe6&ҳ=^h,9X͓9Yi* ć[&bsq>:ы KV9jNx Ԁ;z'+]q}ݎO᜝>/nݫfvz=2y~W,sr'#/n7&rrG"nyI{vl]mٲ%3vri4r1jtj"&rFם޹ kطh.WcvC`)[3k!~˘Ʒ,TkQI$WYg#rW9ʪu,π}1{=GUk+\"Tꊞ(\9c׵湪s\5Qȩࠨ~5X+6幌ryTk[qXsЧ-Og+MִS[rG {iF(ޙ jȽgbGVH᫔ϤGXM/qi`uKc1񏴖:*֤tCO5,|\m_W[TՕ2otףcUd>Xf1X,SNw1lFW5,fB̖ KrQI5k潏j9j:OP=>+1kߐd+c3E{ቨJ39~Nwigf\aNG^92zb5}~Wv]`vEVBE%㸾Bɼڧ4cdWO=J=_>)*ōSR/yپq_w{?Js#EK8=s$i%kٗ%T<1#x3e^x3oO|m ;|c3w g5.QcȞKsh{4Oy_>,oWy zeNo#mg3z5#ϽrCDEF휑嶌c{_vNaptEJ) uXc| [9-!w%cab6 ! F9χAק,^&R h#AV,ط"fi'|<=^>u_<(JÀy<5f""DW2=Z޿:BoovҚGo/ʜݷ;(v@׊Ԯ 7(jؼ4#iȚr+ky>  ǚ~ ċSڧRVTdhUW""sA^ŗ+,1F~uF"Bib8;|f,4.|,UU+mɚ^^/C Wxf;'\S}Kɘȍ{K⊜Q#QI&97Cx mXKҗ0ވ>=_+YcNX|C[ROd*_ʞnD/Bd{sk-|_65QUbԷ<z7 po\WC%St;Rw';%jyy0U:+|g];ʶyϻ}b{~=錭Uٷ uI_W^][MGzB6}U'*',]~ǭꪽ|SěG?I^?!$q2=&_!eܸ[UHU4/c=DrL^)ݣcI >9w%q'B契ֲףW'5DTL6%Q1z/ִ*|Tg4 I]W9)D꿂,E~_xm([=#}vVWhΑkkڝXWXwf%sQTckzt~v `Wjܶ7ѲVwu9TcQ8_v:|A9ĄEXt_/3UUSrQs'O2*ķW3| hNygJ_4ٱGZK59 wmՁ\m!oD/J)[yeӱ\W miC; |_֬׉U6O|Iׯ<<}lW_ND_NٕS}u_-|I+t:כ,O ȴ!;7i[#iqkFHV6MȜuKF*u5|*8^ۺc`QWZm#)~^˺iW7zx`Fu꨿GųȝV?2nFu:qn ͪG9md7{үxF3_OկYnCxlvȼTn6<5t'e7 W>ⱈQ*YWFQٙ{#v:XMׇWגE_%z A]>ɕPήTDE[ײ䑉}~|W?D%***/EETTQST,,R,O hec)crH菎Hފj**tRRG$2I)b{)Ir"9cQQS)⟇f9Rl|6+K$91QQHGw1{gduGس׀FX *h zuR"Bq{vlZf׃۸]S݇qQy=y,}"Iz}S9$'9Zܬ{WTTRta|cب|+oTN c:N~|]~; w[֓[u4y$QJ<\I^I+c2erP3vo ջ*W^ūr.7fbWлvԞV[EX!Wh'DXj}iQ\Jy'Scr "*ڷח/CӛԭsE}KWI}Xq.[_׹ _ [٢\/f웾v7(Crec|59!&t),aOvsd{G`d&'6 /s9񨪭*x]AOc L06 ڏ_vJCWR \`vF_u.5F%(#ibcY^6"Tk֧UU^\&_fXs[s9=a0[r\cq*DfiQ\""e粘& FO/ݭba} FԣFx$r"5W9ֵsDN \Nq|c HƝb$3ي~on/^k,bmöJ|4n纳e|ްJLEƷ%I&&o%LqzE /z|ecᶮ|hp.VQIZbٓ㡃_#$zto_w_RU>?QJiYgIIYe{YsG{ðgi󙍛gǰR̷ry_%=S)3>Y{+T_3ly|Yng7k)2O%zY_v̮i{G+@ns=sW9Us^Uꪪi[nY+(܎._4R+~_uWk}HޫDF[zez9]9ֵ݅جw0pr3i-I26ZdcTjwb3u!35֪٭;Ob\5u6J\}.J<~y;Ya9YrbWcr31HblWe-b$ի&E rurx-x>/nC/О*{zVֺjvZ/:}g5QE7}^vkdN۩ߚYxTmlkҮɯ;! 6+ݬ*قWۻN|ጿ%v>?)թ>{F*6s cr9:nځϯhKA7[fOb\c<ʋ{}w._\KdbxLJ29,\hWtߙ$v5ZjZ ꨲ#f$]zV$I>TjBVn!"&(?ѥ*nEnד|W* voެXܗo&Ѫer&фarYgwN3ׅqհH^ywfC赲#m&ͪ _a?g_r֩ k lrU]nӢ/֗ ^Zt/>wO̹zb3\{ŚmZ/~m;exVXXخZ\>uU'dadIb7)qrF:w;KUPEj#Z+UkCcfneL_Qz"9U:*kT_=)TT$: m$]U+<붺ӫK%%JStn?s3Y"9+Kқ킶z#%4kyfW鵴ףSҏWVI^U/ghS|_F)]Q_ޕC=яOӫ)9e,&O;G%3Q(\oFOw'.)V짷as_>bڬW/ҵE"S:""ڝSk<7-u<?RCU*V9~zovQ[^Zw=cS0{ LW!f2;s_~샵<}=|w:+vE>oZ& 㻨mz:_*|i __H\z&|s>ex]/%#U˔yCUasNg,t{HSnIaWYo{U"(xb;ZVVojR9^Dst0K<}>O¶O''%Ƶ:9ؼ_|ڹ74ʟ{*-U_'b{|wmpsVיժմk1U Tߕ禑WΟ!oXZ;Hjs9qfB3AIʿEc4 HZߚ\UǓ>AV0*v'''k>L]fn6Ρq?6*Ա?s?ǩoÓvp/uXJ&#dHU:뜑yQҳ>_7T+% }w C*HxvrU:7Ftl_7T3'WWr*%&_]$HX9:ibUN'V诋1[n7EKۇ1pMvȺ.wlēնɪ;VD*ۖTUctcrỀKKVl>>ḻew-u+6#Tc;zCVhܤ-@dkO#OT^$"m{ruiRL&^8j3/^iLVs<̖rWGIUbd3F+,{Գ$Iת XW_TNJu/ol5f{]P_>7N&\үĴ{bG{(g0čt>ues [c|v Gaw{ĿU_w!PXܮ73R;ثr$2hrUY#zTC3 {?-:3quq㽛cIfؙFaRN&=7Εn]?|m+;C=Y|mKFi_TI*XlVKi-FW9w܎o_>G'΋|D9 ;Ju5ynl*OUGQ|U<[3# t1=A$۱OM6u(`DJjq6nEڑ\[VO]*Ë)'z4vPם`yi] ĶC6ʎ&n5ZCFMfzDNg\u&#q{EY),K.i"9+vd$_ah垻"e.oZUO<$w_T]hFj"5< ק^ Z^j2 C[0QkQ֢"'Cd0Z׊*0A laȢ&#YQj"""tBo"tOODӘ+m:%'os%E~VϻrηK ] ,kr-$͟otbGj%6:W5$P%iGrj4tvVED^tknNG'G9=7==CMEni#g4:r֊_%ݯm1#6ܣu: p>E7jrDƏv:_b{^'UD3]8v|5 #fVR<+BKVv]h?jؔDkNwX^==^q;#^̉=ڸsi-f{+cQ+j"'UX3Z*!_ ?b}8' a#Wz*ϗ>MZYwfF]=s4(uގ>g5zְIGx'̞=/f"pf6Ù|V nP۸zX<7[sr]YV.Z/߅븫j[ sӢY^/6UvƫMg3Xy[!F>JХWVW5=~Bv2تO warE#b *_OUH汌k1Es9Q֢uU_CkksFjusDPH=E$9||ːWytdN_f^ ة5R$^\X P_UW*ma6.cm/,xNh۱DXhحՑK_zc9_q?ogsusJͻrlqIFF6:/Ub4h99SH73AS_a:* ?=>Sꯊe ds7d-ȫYUw&b U|Ƶ!컏;s\0n9&ݻ&QĶS]5zL寊ԥ_e :=wS󒶎O2ϗ/cjI4p_ +K+ ~:ZPu_gz.[vWOjg+ D|jtk2""!IsGZl^˖炃GIjV퉯TtE]kTL~ 3rc%V~0}9GIhSV{c}~+?-L5\iFHF[{㖩פ0oIxXypy f^>5z*E*_YS͚tI1rx zuIP ߄;ӻk7{\Y[8w"rqDB?\cHxRuSh; Xe^HO(1i2&66'5CG\rVǚԒ?+.?tS#~uQ=SIRF;V/N>JQEƼ^ڿ7Mn>$ f= *9-ݟcÒy19cD7(Ca]m[F(_ȳPd^nU&7#lVg_x?rӸf{ٯk;`3]yzUޱFXHLN;Oe˝p/޲74Xpih,|]'G# dw)۽L"vc:\tXqֱlD:\+7j7*#uUb'"}z⿾-s\r+\VEG5Ƚ~KT-YzWiXvᒵHlV^fh,A3c"*Xb[j-{5D,WO l VDs\HEQQU**|Oîp}$=$nk7+ǵz{U5S*x3r`krx|f[3,cr4F"'HsUN3'h ؜2{ܦ228elnѻVHԷZf#75r"+UVj**x*K,aZtgb>NG#/#S=< ,-nSW|g;:Vǻzz5cmQ۲9nV+{d=Z6$N17|}݄9n~Mmq~TbةlWb[7$wr&N&5#X[QGM;"h̖Wk9QulaѲי~G"uOꊊl\߾׻g9:)$ec5 LXoN:Uv*tg'uQy A)_6i\k9]G,g[,+$/GLjW!ILc_;'_*uoVW)ձ[y|O3<_7^S%,迦_bqa۵̖|C{x<ѝ|r.։COۮ_e}}/a{si콴^󷯙8,]|7ק޽:^Ji? ?&s_ G/?cw.cΉ7W_ G_?p~\o_hA:'\&+>XswtO MW8}ۃ7G?p?pEOcn> ?&5_(n˟;}MkQ}?%"hh9J8߲e^ϭ^.yyƇ#GN} /_(Mi>}2?Ox{uT}7<ӛ}Vr6 o?دߺ}0%{?t3>k>/=z%fUvJ5|w:rQ?wL~/ާc?LMGeof*Xˌ{\c{ިֱEW9UDkZU|G#ceשxvr9,F4}(_f,*)ԯYFƫuݧo#Z>i޽vxӥNOͻvg|pVZ${b*!UU| [j|cXXOiKIX/Oq*-N>믳׋ez]nb0;-rxŘ㲚n(ĵXmKmz|A9 Gm]m2qq;#r's8iO%+%C r.;c'KY{jUWſ|Y-Ư_[Y~d_V9*UsUsUU|UUL ۵~՛׬ػv퉭ܹni,ڷj̎ś6&s=^Ur].Xݹjسfįŋc 쎱;8[bmu˺l^rK"b6JQ# \w֖K5o=|rnLǾroK5f\aˏU^Xˎ|tIb/+ka&wD*9r|OyuMabf5#VEjYeXWV>UE6uvmێgn{c{FeěubѷUyd\_i*ڏO'Mګ#z*l쫽^Äpyxcw;%%vmssd5= {z~<|oEIm$kC'OOS_SNs؝o>W3n:tDEsIdw z<*x5DUJg#Ɯcr/[y5mSNi6l׶fdZ(X$M,r+8[(yndr\,9Ke;MTXZ$1#:.VڕDϝ|U_j}'2!E9gԉd c9R1zO/TEHczt.oZ_U#Z\ٖ-^ e=qR'n,6VgX"[IL, j7_^9gnXg8fGkKȫoNM9c#FDbˤ<ֹ\b٬1nK*s[ 6"|:~{J<Okasҕ\"DF'0kfƷwvt#^\{%+7txr9oJ<7A>IcЛkf^67~u~>36e3blugbue.,ٲUOcη-:1sJFж9])9~EU_/諾~X|S>sgs#s^ǵcs"9kkz{\׵c9湪k5 sV+^YzA̱]<|] 9$7"ܱ6*5TVTvQ6=Ū?9Źp fIkY5\'nXKقY\Eb~8__ .ݬǯ>RuV_fK{x)xz'Vzׅ"U迅E:&g6 u B.WyVW~' }h(cZ\7v}?7*也d9{%gbjv= SOX謡R9]ruC W%z?hI#U=\nQtKՐ3.r}FSk|l7S܋/XOl'z[.䟑~d`{2*:>iۣ+9]dhB׾%˧w'wCA^ubrT0 c+1cG:2=WsʝʽcF>2*cUV?W^*з#b*^SODCL99@;cu=\=?,+5*dZ2I<'XW{tw)>rPsFIwTn^Gَlm$MX))jGVr9C~%. Բ;}UW)Vٲ*_뭥ͥ$UQo,G9̽Q}k"=2Fts}GuOS^;fLyǘz66"C$rFƦ ^Gu9W=x|Gm]oWֵMqdt!NY&蟾r$;c7FDZUcG5rtT_S'+YfC .bs|;8'+%<3'6d([M dHk5vCQZdc}koRȬԹRNXk_ڭr"+UZV***/EEEEE><韀~kUk湪**xPZ6)]btTJ֪Z#ff\ɠGTs\sWb-Ԟjk,W,34Nl G5Ts\OUEEETT^਩*/'nS,):73f|ao|Ňާg4\z}ujmv3ƶrfINE\Gj[V9,g_Nla^dwG0: 1ݪPj$^ rtWH f£c#R4"^v+kӢuz<Ɵʿ:}GUUa6 Gn٣9}R <TNUOcd='yW6TaWv2Lktާk^5+fvmݩzk_w<^kWYkDnnW]tgZ WLz9 RzF#I1~bP *l4O]o_>}/{oqiҼ{/gɺtYX_7~y4P~}޽g~QLJNoS gK#쯓W5b޴/qw{Ǽ.ofP{ǻ{)o7{<_kOuԔ?wcCA:'\+kQ3n˟;}MkQ}??w?1D+D/?cw.cΉ7W_ G_?p~\o_hA:'\&+>XswtO MW8}ۄN&w쟳Z.7[y<~ya?5ݷ>>[֩}k?o7m#h#ԏSO~2wn_iߤgibӋu~<]zSjb:߿{I#UNx "bcB`vF_u.5FkVw*`dY{ 9&t |pއ)m]@ұ>Ӱ[mW4WO#b6FE~|rW*7)]6?[_&ܪ$]Q:ZwȞ]V^2z{G v-6*b\v3q8MyL{ڱj5+Vjp>VZnM9>$w}a,ܒZ[7%>ɇYԒjuf;=B;Ms_ :}E|? >DWxA r tUHʑ^G*EW""*EKz zm>v )ڧ5iЭ0Uג`9s f۸R{(d#=I-E<`=<3wZ5Nwb[_ ePEbIv>;!-28%|˿qrԝ[xF35ӅWN6K$RG#DZG1ruG5^{ X|VQ೸9.cjܮ''V+>w^dK#z9ˬfO8{2<^J׎+ԭ@fҶHb^")8r#T^>TT>Hb5|=Iv%x[1wʘ<We۰燍u25:ڵe&uf`; w 0}ܸǶҺʼ8Xg\Nj,Z.ON4aZlW@k]CKREr/K2{W&j!$UUUUUUzʪ:<YYe%GI$zʪLv$IYd|I,9ϒIsUs*UR?3RM$pW8I$zXW=rDDzsi5c =%K 8|o18[g[l;`,qN՟Xx;̗ٱV%c  Cw5Uu;;bo4ŧي E훯h,lQ/菲u USҢ450XELI~:~(Պ?Y}o3yЇx>S۹/ g9ؘܽV_h&D=*=#Oi'*}#scDU]щ8 V>Vizƿ£Hr8lWn׵6`Y &F#\ǵ~ :VȚ[L KY޴WꛎkYR$fjsD/<-VwLGXu٭f+[^ٱ)U+ڡvxXNcڎk+\ڸ7VͶ[TvrYq9 %=WD.7(srn;]=Z]4 |goh3\={#J-JBZ&:#c,އÝٟp?j|a-šu7渋-mJN4vzw'k{YTFGQ[G>Z3/UM<ܿQЪ?V}E){mжM.&bZzR|}ټ|2*uZǯETEDk vif?n/8e$Sx[th3#IYDR -rP ck7%cc$NGC;R;5G׳/r"VvrT\_81ˮvZۏ2Xi9=;y²tnDlkowNWڸeVEpӂTŊ#Uc!n^\w)gӭ6tnzݪGY&#ni[EVuIU+H7̪9~~|k棚sUjTTTTT3nQ^NIV[1jkXφz{VM5W^ u'[Pbz+ MsUZ*/B3EEDT^(⊋*)v`[o)OiFcqţI΍Se'Ο17Wzzw<َ% g5OŶ1LuBϳ~Ϫ5kuzwzNOqίN(E,s^;,\㥏t< |ʮo_'TF5&3Lut1*9>,[HTfiOjF_,SȄkss!QƺKp>J۵Gp-Ƕmyj= :ydUTtm'jS {e7 z2%!ض|VN$zo^'Qi#&67\5OtmNA}2VZ|z/g#>TM^d[7+T8oxbr/4l);ruc.? {#|XluV՛ڽF}:{(;_@]r5zlSFWfͱ5}㱌sX񔫣etcъ:+<ȟ蓹*tyrL{vЭ5˶!Rk,,Hء6|TkSEH38oBڹK7m_8F雡73Ү=j译cQ^梁L82͌H汍s#"skQ\*DOP Nb+,pS5Qg({T:?+n$״nO4Y\i"Lf'^7^:q5#*4668j5Gx)Ùϸak2GB,vagFE#QUz+C~6^,=OQѱzV*{uZF%9"SnbliRqe1eXVXjkR ]\Zڲ$Y#r"Ts^TsW\TTTUBg5rnsWżǹvdp$sī~BջN%~ֳK$nߕjmTv(z*GW*֢uW~'m:<͢zcp5&ĝ,en<>:mٵ Ѳ7(1nmUƁ8ֹv:X:kg{c(r"}OWS՛spOl.+lNs;0$tW5N>8qȳ߁f ;}_V _s[-_jaG$2*ZFHCџo݇{hyqpE%My1"XA"9x>)2P*OiRwk b't}z),:F·OjapW8 acb(؈GlFkS"""!Y5+]j:nԵ=gKk&]쩎0q^>M EQFkZhX,V⵽g u &taezXV/ z8E 18kQ: k1cֵkZjtDDCX$$q67n|)F1$kY_*U g{ >Gy\߇7J5}z|+&+ñci}YFyj\ZUdG4ֵyrEdMp^~{ӻ5N_'Vi`9]Z\ dUv4GY0~ gu2l}/"*aQ<2'DGS%۩fA%kuf jXf#{W!zqO3/"qɗ7m7e63= cl kܣvӫUZvҶ7m}rږ2ZӬiC1-IK%ԙH,Ե TUEE%L V:9#rrts\TY 칝W#O ql1Q%Dkۃ6x]ŪR{#ùO.mskз [=zː9]lYӹTtuʋ9*ȩ=Ids{U/L_/6Zn 5%WtG;fYݵK=mQzYzv2V(ߵ*ʱ:#dY#>Gz7E+@^Y`FUk~"=_+lrVzrX~<¶sڬ4˸=Uy,Jڵw}.Qv˚خMsH嵱[}H|mtӕxjQ8?k"Wj䆤QH-+k-k,M6jbs:Ef4Oo]][#ؾ ?̾ y秴Rq?|' ~x]5lF kgXTJSU]Am?_6ܷO?]4_ '%FEY[32#dl|=\Fj+ʍkZꪾG'1 g!GQev1+nC!zܑUFX$mW9QT_GFS)v7fG#~4УNطvZk#1W9QTUFʈY=8f88n,ZH*5a3K$eVK d}>)'V"x:Ңv+C֐x뺆ǵΰ`v.#]Du_L>DR;#OlV'7.Mڻk\[ȬdΏk佖|V[nZcWoگbwIÛ>; ].?֞l͇zˏ1}*-^_c w/d_]/GIؙ<^7^!P:n5g#԰HN=~O|UTH>GxL{4'5:u1[']fyUtV/Okx\%gDJڷ9S5V̪Y}3$Y=v뵫c} c(1xdg=R*ƵRRddsקNe3XC+1m*`!Z|՘9NE]f7vMXV*XM#\DL&X4mE,̑'O=9Vsէ^wHT0"yh"_2Tj}"5 N&"تfƪtUV"ÉQ|.6Y%\~'^ QYJHkIccZ+z|wc>'1td|IKҨ%kY,[Q>F1ʭꨈwjtn>S%H?x)G$NUub&wz-8;.+RMCn1ʓI^GzduVUҪQH''VQVF}$|/w^sUUFG.%I%h_獭_vw"LuoV 'FQ|Kgs_JT9f5rfC{{|g|X EAN6*,;VA̴U)\/yO7>K^D |UkkߢẕaEE-g/᠙/{V;?8Ig_~\\ģk~UH|VO#/=|p+1eɚx~:9nU*ToH\w/~V?|vJ䊌,5{l;j$.grj=]KR۽λ>zQ/M]%)[q)>U**H5SZ觯b7<25z:9bQQWxѷ^2>?}Gfw?-oi{ 'Zn F{K+T7і <"_Sx;H{l'⭵S Զ|r>I0fj9UX+Gl˸~+tnwᝊBq,c',.Nul{Jk9WUVӒ/Ww╽Q~v9? ;SꞹR; =K>_/?? ,nTUXSM'OֵTj*n~w)7ڸcXƭk['֫X }eٕ}'VXrh*AվS47MK4 /^vIf̐ֆYYd+ck>͗X:+zcStO(KtMײR,ubsێZ rg}#SJ=Sj5_?U{ߙ̵N%8{TK-:]pAJ֢m6(jR?C~"rM3 g#[rIu.4׮I-jhV\˓.e獶oLF Ve,UR=z}'/d($\jIuGOSg6/Α$O]#FROPeprӧliG,\TۛEOm_Z: Wj^w2\#;="GqH^4d(li{+{XpgTHhrYZ5G(z|DOz;0uk$vTOiW_"S2sGVeNHwe5k1Sx~EO7}!nUPwG; Zo VBS#w{njWjuvX&<'œ{EbgEIr _T_45U?XԾ |+&}>ew_~r:gޛMh=7* jNj7Jm2lIȒ5dsխXGfYjc{ jKxgY$H.x,ĕ*GyU^V6%1h_NRF{95zFx}qg]YS?MN=؜`ݕO>|fO wkE؊έ*ӡ09NR}ǻy_Rws]Z5) _d梷Ds.7}%O`TCĽEl./7_1?UEN\{ T@Gjjz#&yfl}W5U zGLRbٷξߎ1/{}y8#{/g:=UtT~>z`T`aaZmLK±Vo_ʓ,އaۖl=pnX|odhb^#z>kvb% g~~=N3b5m+ށ~ϕV ."7t*y$<{?_Vz+XG?*ȏj$Or]K=\, *eaӶƯE}[,NN {zN=75_ݟf[N)gˑKзs_6(WÓ٣Kkbqݿd]A&W47]eYS/ԫIkYf1VWE~ebY X66_enFQH"}}ʟ:! 4Rq8G|v{k':-NYKcgUU9Q_csQlO_.w{ĹkvSuV8;s\۵I*ᱭylק#OGzc=Ԛr\7s_؝ Vm-e9k2K4|inh1֞+٠rCS-B٪XRNOt+*}r|(fzunhUbg86$rX5: ;ΛZnȜtH6p2泮a)-,v7J,=cCf٬hzt3WQq.˟[a1Ue27$*4#܍kSHȘ${Y{ިֵN*""\o>MbYhV/ ܳ~G#z$EO $o" h~#otW<=׵˙)yOkއgxӉrGFl97tȭh'Z{~lvyqnx=jr5Sێ[E㜋Jje2`Yh$m\WǹTkN|>GE O9>^!! ;Lg8 nn&ۋ.7c~E+m[sU'~ҧ36Oᗥ>w Q ׹l\OkJ='Ms8_أ_zZ`L;/ùOuq? k܏)-mxVh28~>EFEs4 e񾽬%AWE>i%T證~d]'VUשUjFؠ0㍈1O:/OO^Ut}#RچkιB1<&Lf+N#"ͳX']:n5]sWZ.Rq8kPѫQlc:"dllqc1ֵ#Z1J~EV^kԙ;da!oF5veDY#Sʸ=zi+?]NؗչbE\66yʆ:v8Z2fXV8VNTeu"htY~3D_ܰ|-m-W*RO-1j8z٭|9׫XbFy&Dٺ''DQ~Dw링Dy 1wmcvϯfrx*_EV.eMwm;1FSNt-%a:-[j6j-Kdx$#;-NJ?Yi܁٭eHٖѺJJױ j4/|Oc)Ztrdw'>%@2F,ĽZb>+9O>t訊Gyvz?v3<bJ{οxZ՟>#n RzW#X9VOyO \eMG3,Jͳ?ZXF;hNetR7׷d_~ǜ#\3=QrT{ vE/[wM'ls7?*>Z+ w)\3_HE;h/' ?X{jy#bV2NXr62>k 1 $VOū{X|]ߵ|UKo@?51<̡a/2vğ)"┢3T)vF_u.5FZ)W}%Eoj9E_#zVu I/b:KAʔܵGp4{__!o~ͭs;﨏)Ojw3:jfgq2.>~JY+6B)%m sQD[ؔiՑ|TE^_>F+~7k{mY1=]\L{zuG+g:V*trB:V[cԍpa]=ŧk6j:9$&:xktWk9\#K~{Z>t io{++:Ŕlm+< Z\&? tuj]z,' }^w|r:]E_M<[_z}s+޾:c(del+;zATuHʭfjXjT%oRO7 pW*^; {iBMx-ejX*5oQ||}^ʽW\},jv)7ޠjD.!0})S͎ڟd/r?[ ڍe_hmj"_ r{ڙO~|mVJ{/#J _Ѯ,kgmE芪Q}xN-/YaNxޤ~S˟m^|-Rbu# eV&&+Q|U:sztvwo5ܭw֩rs r%iM=1rpnųfVIp8W޽2d>8O7nܧWuyJ亘Ike6fϪp{+V uWJZph*Eguf:Iթ,s#VV5F#5zyN)! ;Lg8 ୥٭^L-KHm㩗=$Z;#FFg[B9IdV=jr1WkqQ[XDXr#E_{c٬*/fQQgWY}#xyݛwd㧳V)K~=qw fH62H㶟/p9FQ/p+g*U;-ThZUl s|oV&c1'$Eg/EF7U(h3~EյJգ:19zH\9|MNz]m,l_Fp'nlɫvqY=䵖ɺK~ݹڮ#RʝgnFpz~-'珬ulf* uDZdu>7ٹew&*1HF:ޱZ*DO=V1˪mysg_zW5檵kEObhdk{QsWVTRyW$mzYQ rYH绫*59UwFUUaísӞ[vS=vWgg :S?9k!^kn*Yz֭[Eky.w!ul^:.j{y37.̍c6f?%jI-ԴݖY%ʼn_kr9Ԝb\(UЪDUE_VGyk!'3$9\!=5^}V΋G}̞ۗs{mkڑe^q'9%jD +4'yɽu眖sLr:,_ol="\Ƈ$-UI.kʫNn)c\֕PUD]%d_Ei?-hSW!VV"RLE4R'cਨm/NKd?xp9_Z^_e~S=yx9Ecѯkt]N;Z.=pێѯއ%aP<>w:97}g5ȭr#Q&R4l'Hj=bTꊊd%*k:VRO]51EylzGצdj&,=,;ݰ9_vooar ˖\~s?BfH٫d45T]DlR޴}OOdڱp.P''Բr S/"5"#_ UzK:{?W2*9#] 4 6Tij~.Y(Qog֧Wɋsf|L7uIqv[%{O.PCkyDcgVRk\k3-gFv$a\&c+ǜ.Qu>@ߠcWL=UWBO--s#7IbWEUY:K*WB Fj%nM6FЫ]väQ&wF7D[hzY~|ܳ/v= ܩʙJ{<ŘYsS!qԛ||7=;Wޗݱѽ]O]ZQz5mY򯌏O|5Wzzr乃av,xǶ')u8L?m zgN"oNg6s#\VүBҫ@CT7 2oRen_%܋i,*:TUx z*ewC8hiNr;Ws|͐Y_#faX+[$VfzCd 6:E z+UL6Myy}LUW"to_0xʲi{lw%V`qFRij9k#4ZrI X"79G#dcEEEz!Z`uInO{pulنU2,Hc;Wwqnj5l]e VĹ utL4H]vK3?]_ȶ@MгWDTnrFFUi^i.݅\V2f$xzV+.=.Ve%ttbz&x̩iSS-*}~1,CG\kcݰXllbKvwO$P-@Xt *sٮE|%fnrW)]G5NwS]dZk\\sO oP۸whv6yG3񮳚\KgZaXd}^r_MȈFBJTje. <>DD Аx#d0 PQlF8cQDDDИQ1mk#65cQ1?NC/#kfVbDD$OW_3cC_{ׯ.%)Vv\WHѽ? ǧp]Wd`(/HGhi*[٩//:/DQ7Azyľ]q/v\=;`rm#nEyhC`vLVu1l^K+ZYFUOoZv=`Z3;N_5mw9N1xV> $k"&>GQO1==r5b+*FUUJи%7oHJZN>Ŧ|e(=z#ەsgZ}ը1%vuͤ̚sװj{FTu{sn*G B,H2xNYioolG9\=k=驶? leWͦx'5|WޯTJu(WS8kVAlqFֱOw'T]t .R/UU|DW*UU2tm/u\&zizq"աJzc⪤yQl6'c5DDCFT}/78ܳFYcT6f5}?2Wbk>ivm5-8=oQ-;θCa(>1}ϣasLmlZԧҏQ]Թuxqk79Zhk;[#847[r+LKFjd`_:$VVZE"/|ʅ )skޥ*+ŮEDtsD 7#UoOk?glV4V⭂\ŋz6>+]\>-]1FR"7̭Mp([s.6|{|㵋.8[v]n'Q%ұ-[ VKO~vf=E< 4u \C0ʚ^f2יUYÑb/Y2~:*Ƣz^j.歖}+b|Ӿ\ Uk׎Y*8w'm$Wކާx3scn>+*QHgSilIe6;*ɏiq_rI:ʿEo|~d+QQQS*xd+E<<ɡHF)d"Ȫ 422XcdX$oj9F{UQQI~@4XZk=-wBp٨geRIQX, b*|!.{텸'OH+63>vߞ<.b垲6|:#y! GԻv>i' qyéA[ݲdrXFc`U]G"",*u{j5'rm,.p_ c6 .]"-fܑVmDlҧWZW?3zsK92ؽK6G]Jܲ|keFt<˔ee^ϐƢ$UZle*6~1^I*(<]/`ܮ-\-5RaMŏ+1#W3ǝqٌFH[屮pUXӸޒ,bd3w"c^G2-{mgo$c9@Fs#NUO*2zӂxzTTΥ7_Oopso1ܩnV'6mz~r6OT0od$V`ry{$;ˆ⭓9HZYG![HíeDlJz'*Ucuԯz׵e~g+ߙSĠHfߏϱdr#'DFl(DG!S{}${%܆{|ۿ.٤ʍߴHmC VeyDvYУ㎵5zwoޜ嫛Gmx['5(E~M kjWu)EW-~V 1Z ?ˈUT#F"-ynre>?7+YNsu(\$v ݿgœ̻'nCNOu-[恖ɉ4q?RhQw/voJ5کnbaիm:6?nӲ25㶽jݪ2ʮ'IYF1ܡr\}-(^VbIgU>:l Y*R{Zr"X|>e7x/}pe۞`u>I2du K?2TW+NCjV̜kփLZ~$F;>*cd{mm%rQwj Sľh捒~^szEpxrS XefXoy{c(jI${1?mƇ{a=;Pvmhrq8w]џ%r;֒i(r"6ű`uojs8wYֱ9 ݯapr REZ>(,8ڮUDClls汌jr5jus'n?jY:G҉YmQa߁Nry#uK|A%8 mfӻ 2͇kok^vLM{y'1$W~ԫ]Xov45}Y\wYOȤXsR!Yuro%|v\M5-DێdTFð?'*׬2k-[.EK"|D_~O|~I$Y!vÇf7ƶ#S*WchW~>HJ*288ڍj""! 84xU1mJ1FpJTWduԫ^68ֱj5DF5<;l)NUԉb)ceA#\lӢy\1>Fsխ4#.~ ]0UmVĻ.n^#޳Nb G7Jmzkr6[6e͆MLE'pw48KCOfqESQ;堳'mEƷ5IpXzI=2TaW$Tj@{998sk蟂c}ryzPs^a.0εR%: +>I!{WUB3k|kܯom/`?gѶŎJ]`ƹ5츛QR}v$U:qp=rl|s sj٘<Xo8ls"`3饩zbbꊝb+5ެ'y*/̭r~OO U-O7M7JՊ_7ԯD+9|Z9Qѹz=0=B볎0# wa&\_\^[5jٱ]"L;n%bf{;BEdX9owWfөۙׯI㍮{#X5{FjuU_Cp܆g3(;ucq{!nHңJOYd{c6u/ߣw)SԳ#fthQ [v݇^Jskƫ~*Q\DDEUU^*QG,\u3= 櫘{1L|j O<ʈTǯwԏ2=qf*(Ms'r!NJ٫$Yx vݨfcrw[s-"\^vfi?6d7ѫ&](ƹXı$Q;&y)g*QS{̍_O}& \ 5^)'y0I,dq\DDDUUSյmxu3L[f߶f毫˹c3Waax<>: [)WjQ__^w lŲlYJL BS3-EKciE5̆G!rfE 11K#EUD>H汍s#XƢs5UUU|< cs,%T}J|Zjm̟vGte#Q#]z?;4KOoP1:nՈf5g,ړ*^I*n[0ZVC1pq#,Jk:{~?Ԩ&2(Ȣ㍭cƧFj#Z֢tDO3a'X F3QⱴaezXn:PSFxQDGj""!38N.z^2zu6 ҫUT Z5j#ZֵDDDODDDCr2.>\q/sYG}fK9}@嬶[-_ET~Of޴o Y滙A /ȋ"u-5"Fvׯ7CG":wmְx<Wk'$^x \OaHƵ>[8k$w.ok+UbE Uڬ"_I 7tWy||;mPH=G_|}e+V~C2',EI":?/>Rn;&umÇj>-:BGߟj4E*}6GzV^XSGף-2JU5i'ߕm6/lQq+33#18$DGYs\uTTWFUR˞ޱE۔Er~?7ӆ|39 qZ޷ܣwupW6I$=S=LӇ?imW|e++rj2;njZ3ى#eZ׽A0+yףJJdLUOBylG;ږR,M*_S"4cֵ:""Km9 =ܯYiϟwj$xYVTR 4*#j558qܟ4y}<17Ilf2hXl*H)PU)cb61f{Ib̎YZ#ZDOC$q**۷Xmc\doV|C^w_ŋ^>6Dhjv7#Nsc:UHRDYkzx(Ǫ"wT*(ͼʜʕճF1٩n kقTG41c7c>Ohǻr~ݸ5\u]caG1[7+׷kEHWy5.K6ߵcU|\u4UR>tOD|N_:r(@s~B~'W NIq)юG/*z^l'W/o֟/;`jtwA,rKd`:q+%EZy*䚵vVK%|?ڹo2oӲEGD嬵xs&Ԫr#Oyݐ|цZsaΖ_'9|+U_xh4 *{Zj"ήܸ|8Λnn|JS 9)DžUl=GNDUN٩V[` uyEs O3SV:x"9D$tYlJ{{Mݽvƽq9<=`a yW`0ئط 9?2f|^ծ޸7F88ڋh|Wu<:,QEg 0yB\˘F\,'}JS XSpFW=U~PD; SȜb} ^!KXuAA"r9Z3"Oj\[},5 qKp< ٰ\m>plj1[7Zܯvи1zg%$ϣNhH,ykrݻai&z'8؝ 1k֧"o;M体cwYͧexp񵣯ֵ|,/41x+c pV6\3 WdeN}v"j§ΐVg}hS6K 2kcMh^ӴL6G%UQl:Dߧ#Q@>:LU16 tkZM$Pޫ_9UWM|!qۧWR"u?ѵꊯn;]1xٲrV"ۙ_b$gYM \EҲq-v}z9mmN䊗+SCg~nN\fkoK ܙCm1&]ΰH~8\:}@Ph,Vxl֖H,W9'+$hHEkȨDvq۬o.Øw]+`zկ_k{.p:EkdG<F9X"mX.>8 llnBDbZk<=*79>dkmSzv.>NsnZy]sa9Nĭ}2zV<.uE;Ę d,kE^SOzqtOC#`G"*>]gg[5^ۄoa^}ϙ\ wqe+{5O3alecX/G:;S^ ؜+řc[&{'GQX3T$WEcNg=6v6wھNTcS?dXjmcTOUԚ7ֹ|Gՙ_rfS羾gj 2ـ㽰qӇ輛I;ZW|4Q\|Oz+ZUb;5ۃ{Bl~2Yobso3l̆hW6Y 7=z*qtor*5P.>kNj|Xj|e)hceW`i$R'^j9EEDTT7a2qpM|Ûf7xVpƍ׳ԣJgC3#B aR"JrATs9>ǟyCnr9 ͞ާ`j=CUC]%c/hɽrxY]B;pǣ-e+I ^7*v;7(boUDEuĮ5]/5\>dUD+gL)>?<.6ڏ[#5o,*~COǥ) XƯO[' /…xG󓒉",LKޙq9paysYzޱ3*t;ZfG )/s'fUksuwI;~q)1:wɜFWAZkȐMkeq=U_/W.ˆd8kZ1;͍ EE~'D[ڳЪgjׅ2/,|X,|{!_5֞[Q? $PD/{׶ϻfһˎ6.R}%?k;/Ɏ5\g-RPc,q\kx+{[8KHr!KVY\̶Z",䆝*tH5TV{2h,/F9~F⪾m?3GEN9>\s^hN"_|TbmwM҇K6waY͖^l>r1veukt6gǍۆu1=-}vy/|g6^;9sc)=Ž&Cud_-q5#1fZֺKLv;0mfOwafmvm1%qUsOZ>vvR[7U_ ^^)prK/_#onH0DJ2I4\u7Mp-6Yյus7_eO$rz5ʈ|mmg񺮕`2Nײl6/Meow_gZ*{"Q:"*!$dq{ܽ5:ʿQ @H0T4ܪsʶuΌNszOs3hCaw sX.Brd/"o^ȼn >Ynlާ{:ر-8[B,_̵NE+En'FmIjLVNV։zTiԧUŋKKxe1EO%:^vGY*uO+W̬З_S~fnq'{Fgcy#[t%,x2udaCjѺ>Ռu=$}y Xl3]ڝ;3ا#|^>^hl2E4k+VsLJ)rնlਝ$.c^+7N 4k7 xj~*Y^.{zB{VmK;w=W8G5/Pxfi,d^_G!eΚ=s8\n58RTOv]عny_5_!/Ym޹,nNKrUW=s<%'L۵Kbdq.D]oOKyy/K)zo(&+-r [d>|-b/jUI g+ ]:zx52xkz؅zF"ƟYտSm dDxc\s;06|ʽWtF^%EEjxxun'7v3]mw\>ޙN݉_jn[y V}aY#R"gXU7yb:Vۚv&{9:W9jp;,OV=ͭZ8oL6-7Wӓ:es?/Dw">̗HnG^.RDL初r'uLr9>X)޲'N#`\maps8sQWp#Kގ<) ꍛULVKb9kb^ ?>!myesxIGq.ң7-mőYQ.F$5c7@o;K6غJ7tIZ}T$JK) o[Mg9~66]^wozs:b{e쏻ݻ);+Rַ{X6uS[_ݳO{|}ZWt^ 7jpqWd/6ڬb[/wWg}۱kVY<|cz6FklNz5U>#+G9̓ѿ,W]⬖'_ۻn#;͚9QnZnr6{ Fﴆ/-I^q[c"j9בH7>?&Ųq%딶mc*)Rמ+425U~?5C5+֥G'uk0ۂ+0;GY~TTN2C'q5Np[rlT{Q)H޿3Q{:*9 |J|fg2-K*/ZVIz$LMxG6qlX1f:,gH\rm'܏tVu|'x*bc{Woc5_}VJ6676y܉TmJlC۞)NdGCM%=e #Wu=>{ 녶'hO*#mETYUǹdkZ9"Ey7qָ9:ffsͯK]iYj+UNHiLtHcUs>rxNJiǕ$w6Y+"/%ӹoŬUv@߇=0u?p{۵#oe1٨&nWH \JyݑΰOPę ~ތzGaX g4 8m]ZR[te9Ҷ_8%jJʏ&^ر /E}xu8 8_r硾;rj޽Y ˑrU}U>?_HMeỊ~0}&N3Y V]Y'S!Ĕ#9θ|J|c!2[?4s_NّG>_NjV5tV2Ybi {,:Ř"Qz}DXPsT` {zlX+rif1UQU>7!ȽVTTQ~E*nRu-JN.g'Irչ7Y_/V4nQ$3FN1buAGtݷrm{~MX+kk'r-jV|r"$jUjJ]2/Oej >"*!rSzyx[&Ïհsy'kӏcj;`EȨ\Hw^}ru-+0nO VhҎǺyzɷ%?Eaaկ<ӏv}f]CumVג66뒦k3&ZHb#:Ï-ף"oTj~ G#b|{>ʾm%m沒+Ċƥf* ڿ޹ʮ^rӾq۲~y+5otLlƙReuzSDjKrܳݰ[bY5~yw+{p<Õuݓkb='R$ɮiW<D͉&:͉|z|-XwWz5OFGE30pV[}=vG/}`]_dȪQ;σ[ԿK(ef<%\/sm+K/QbyK]nW2a2ɷ̖9cܶ؏ EUҮKmnKfG/]`5jY,d= URyd晓dn+3zʿ"D.2X߼_a)1|cj"˄ǾE->iWVUj-7B0Z"HV DO$-W_GǏKԎ ~!o5fTv$9Qv2:'$VUnHEDuH~o_5 (bcB=ѹcDZ=sEkTVQSk5s5UkZ:*9<śK>2, ^I_%g_>Y#+OwE}2{nK~l9t1RbwC|1zZ_n8%kvh2{nxyrorU۴[{nmnO25?!f$ײ C,O y~U4N_FWꪓuc:WR~jUaB :i]⨞ bܙpr70Im]LLn`oȓKNulV6W9G*"uNH?o-ے+ɌxRطm"'J:ZDHsёȊ梪tEoƫ|[s3dٻ"u[DD#[y?]os*n]-|e`AFqx QWD511lsw,s/,׾al$4fsqb+<=iV,j""".Շ۳=?<[w>Qz'z59 33#TYl< O6:$*dՌ^bts||By;3뻇ylWSvsVU"5e2d By-3K<=M4t#׫$U{^TVmen[ז-=9ﵑYIdr+dt4GT@~W3Ϊn>ET_U+=U?tN-͎k?nxZհ̙Z<2ԳRf$W#%jS&pt0drvJk$+Z5$z5EsܨI{{7nvC>okܶZ$N-ls̭2?N)nKz;׫ww9NZy-GOFZd 3LKцQbjZR$Ġ@es<5[$G,nW$VawњEt3O:*"Y;o3?ŝpFc~y[5kΩy=li#}_nI%[-EI`sfGf% vL=9jaG >DIʊ|ʩ:& ;죯h|n6ܐ7l$h[D09Vٴubd@+*+9ot]CYyǴVyoyՅ_W|Să?a|i3M8_W9;LŐ;~V2݁ ;waDi\隄d׬]>'qTf2"`?wwoIc'hAS[ '+!6''WOV^*U5W+:/'o<ϳv|+7l.VWZIgV+iRi#Twݟ|OsUQf_ r~wyWrbBӹ +l-;`וTwږG"|ꊊsWլAaXoz'/BUEn{p;" ~x$n"t]^#NMFrzۦgDfC^q[FFފD誝R0׶{ `o76?j#m語?)={dc$bdkڿUDsWNr*"DOkCoj?qoף*ۃ롿w ? 3 q%bl;?oۇ&h ?S1NJ&,gzeG%m4zfǒIUVBVHTHOV}ExOvLncgS~>jZe*\M7Rk*[f&'ԛ%/+a[iD~]i]ԔrY5xMbHrvfqK-FKӃRČrtO$9W5O%s1NoO%3?t/UF؝֧ZwO[9+yj-m}vrD!XtGV:AUNej4,dQ9_}NMyv {O r.ǒvRS%2A J#`V(ቭjI{filN|=^/_>dOD:$%wًq[rV^sUmEs֢ܽ")7xka'5Ȝ=cN5drJjՇQ[ L}&bHl"^y78Un`uw]ٷrǙ؝ʎ/R9,ݷ2:} #[ %RQ"G2\r֫KdogpqrzV0zoE*,v`4nh:OffZbܳ`Vo+2[lN}|R&/y~dI^ܺ,QM%h=IV>7zxpWg͇ -Vج3J|n[a?%B̐ڬ7UO35x|S`l##^;x')VZ9u5٧zXފױʊsZDs\k'EEOӅ~fpt_\I[*yG'?k9>{\m,<+[~ۼs/msz"MqO}l_5Aw6żk;܏qrZ>fuOioѸ|PF ƪ^9Q~ :)&6 nr}v-TOz'v/_X_TB7:4ܴ6+7xl߸;y'D,/MSf:sL6I5=x*w{~Y>m FΣ2N'eidG%Km1`UOOhD/Eҹ[!Nrzkj X9E7lo&hƜ}gq)iz .=ʴږᆧ]y\T6rV[,5U6\el#e}r#ף (cd9j9zvHBZOFd3b'}TBFMuW޵BfvϷ6~mwAo*b2^ڿb's.E{㽵DX `zpԣRE 11Dj"EkZj#ZFDF=C~*`7}lWu^Nm|z8dc4WVx{ n+Nֹ[@^Esn3lF#aتT~=UW5T~}D;L]<>I<liq>_5 LU|y_/ȯub/̏S#c;j}[%u/MWsglʕ-҃pYR/V' D|1dG3ԛז9isubti/VP裿/z9tI[l,UL}g}NO<^Ueb'ߕm67p snbwe K|YbV9e_҅誊ij8xKw]L׫g3س]Vf+sO)JcW|rI v2,vSz;w c! ~l yFZrS%Ǿ)(5jOxfeXk'ʨ""otEJ{#{ܯ{ު=UW9UUsU|UM:Y C/^dYdY 3]d2f}\l[nĮYds#ܮrۙ+9vo/ٞg˷-J۷fwklL>IsܪIUUUUUUUUU^*⪪|3~R:}zּo|Gv#gU Ytn_g-m^2/:4Zn')kr>KuZ;52 x;OkVK8wb;]5|$pDv+PeRKjmZ#&w#UuՓIBdtպeju4byJ61<ȵ<@q+_.-Mao믠IW i5lҷ>>K]JJɢwdb)qg$5sCN[:^W3lѶ ~Ϯd< ,.:5r|ċxظ|y'O;mݻ[5|G/lZf{ srt"DsW*|$Rc5$R2V/|nG5~\z>J Uo@z#nOtE!9_[rӝyW_cϭ.nk?|G|y\.~X]?A_wll&cLKKֆN5"";D'MrYo;# 7ߠ cy~n@pOPď;GcO\ JQ׈Jp;TiJ?gwŎ#;/c}9!K͍&r~xOaFFe$8-8yfH!$^U<rE>}-{S~9/'ncZ:ƺF;W:f1ӫXuF2HCf;~~;d?jq]DH-KaWa嬝)|,zek㵙5tS֭qyTD( >w'#~"0WY^$|=UsU{UWToes\w;fy̶c1g#er6d$s>YYrT3 lLR嬎O'=܆G!vwٻz/ͻ%G9=*U\*UW9UUUUzyL9Vr5j-6%d0A $K#mEs/DD"Gܹ7r|^.ocv<ȱ&{F(c5=Og|2Vݵe`5kBW7lOc-ڕmW9ʈ}{#|r1b+9z#Z⪪Vm62y(>n/E#~*j*T_EGkw`q+;f4?-:ZkfI b+u:J {2n~; qܿxvbgS%Ҭ-k1 ܶ܎YMS_^G,N}[R\1F<߿9>_<>Yd_X \7!M_x5Zgt{9Sƿ&chkYOʹcEsvJևhw#R6LVr*y|w?' Tڴy[ꮑ׬j:icNą1ٶ#_oxHs^VG5ȽjEEjdqf~i[#VYY=k0JGG4F5DSR՚6] 7:l|6h,ŒtvVmUwܢw'+WIg}/_IٯnY^x$3_{QSh{Ɲ\{e5 mxKֶ_)W7V($hevgy3Y oosVqSl a_eaUhC9,nVI={U"TT.lm36+gez&|d+'UV7ξ>_kAߖԗ}nݯr޹_,1.Șxk:Y,\revIm.h|A5&өlx5>^bEnȠY% Z{;rvbo%B{|5? 3>":*X\\(GP`7X'kr nܼkts5$ܿ-$ eK"g2Fb~-{UѡG;^Ik08]b3|޸Oc cKY7nڰX6yS ?={ܯk0H4ѻofMJJ}-oLx iYnE_<)3z@*}w2U_Ү qd$9IF'lgÏO*9*q?+[/wSLIԷ~yYZZXV;NNFwTtkDFrRp_pܮe4jto1ryڡL""u6ۮ{)еz>䍁:|~)*Q1D^A)s*8L[ 66oDERor}qv7!G"j\kRrksoSӳ~oux;G^RHFU&W Nμ3#hW/Jغۗ5SumbWtd0FQU9%uy'Q.9UaZIҶ65crV6Do*r{I8훃\|?o^577evMsk-{>]{s;n bjOm׆ʌnWcC_s|nԎRtV/pDz"+<8U<5lV W_F[SP׬v&̙4snBvS|KNG$eR},W{{$OhEFN0 Ҡ=8Cqv#4j1iˣQ#WofDO|#>6{fawy1vFUJZOsUA#kkS\-HS+U6?dYsgysg]s,OPù؊(J=-N[D4|IY:jm\K^ Ɏembm&K ȘxAbD]k>OݷFEmXs SJSťnCq5\dImU^5'[)7zUV)/UN^?:t%`ϧzŌk!֢}#z{hv!W1J߳n8N;fm|ڶRV3NB4u+5w-fk.vFu'mO2"&/{ze.AJ u/vȟYBފo-Gyt sZ*h#95̶`1>kF) W?Sl^뜙\^nSQK\l[nG\;oWy[o~):O1<⑓Eѯ9cdwdG5~vHN@%3s]?e~((,g__ܓOK?7_r@Op~4 U+q0SU^Wr__&BU̾~ەcۖƲY$w ,ULH{e{]'hw ޚl&[S-sFg{5{׋f=dtJQ5sdsUM\N 6^_adr]O Mh?G?rCp{yt7Y?!ҔabA`UWn?[_OW͇-pyBf<#DѿdV&bLn]ݾ۶GNU~ iȗ/OlFzXW*%U%'jݫZxˆJ%o{3VWfߚEK*I#$c)ka݈p^ku2ݾvc3qlݻ<`|)Lluq#V9,LQloW;J;{Y=ѿ}U%Ae"?Z9֢TkZUsF1121! +uֵ2y`eGV;6l_{:~&ۮg{{_/d2JuďyW-JW5},vCYƣsg—[{[2vњޠy $umӶ9եw#Q3쇼R%7uyUU:9S".o` QeQ_JQg"WDFzjI>lqyOe$RN7jVk&Ym2xq#J&wa7PL))5IUA֫2o)M[8dDIrӶfhYbwv\غ~tiz|1<$~FYJUW*ʪUU|UUWUTԏbŋv'nyZ4,ٱ+btO<9K49\9Ur54fʼne4#irYe,rTj|WWU~s82xBxͤs$a1k-sUb:%~UNb9*"-=vVnmf0p6nAlRYi0; 6 ّ:/ab'ON Vӆ:j&#Ojt6q$F# ֣R!z/ӚUTٍ 5>YƱvR.6N86G:u W[V+Tt%Ri/Z_8 S߳wn{=L݌юgV9vɐ:'D~W|5>f1dwqצd(dOV ק'dUO?y_dnh.rӟ Y=6N;;~ 6yrxxΈߕzrsCcYwd O=}sVÎ1.k25"*r+ 2+?x,¾hlC;cdbuO nلu Wy֭{x=sS2ck#SѹT۟X[׶0xk't+k, >XH׵jVQx1P4l7+T]تEŴ"DWaj)w}񦷛 c 4QlwcŒ8rWyd=hk4Ubk~~s` jY:>ەL6j^!kܓUUVڲ w)$MwXiuzUdO/F(m bVp:Zn\rU_*^VȌEEX>v9{u=>z8i'Zo'j}7;K9_l.c}j܋I$n*;ygkn^.iѬ6{γk6-c/W- +qvX,פ{9P7؏ k;U+1_{p$b7kd8k5nsN3m"Ͻj{{>̬l-Vcd-SF+l`qRFEݻ-ٕΒdneR/F3V~& OޯUTJ&)\tk=r1b+9QֵUrDDU?Z=c=FEs/FNU_d\ɜ?n/5:1QjZr'!f7U:'EWDݦxI=رj٭>>w2oxl$ig \k e>{ބURq]w18oo깺r2陪3מ ikKv]3({=6YmmϒLrxՍȨ~Ij/IedEQpS>MڜJB zWӻETQl,Ǫu˸ɬ:6S9=z+r,G,ՅX`?godBt7ζԮTU,7Q\ewOjN7% zmU& {eڶF *nN9mmF+"kz;Q\MV]땸H]q-/Uvۗa1 ̒;#w^E^rk<1%׵m+ uVߘ5r^\-jE!赢Pdz1ϹhGjnHuV}/'p9Zn!c6^ٿmSW+އxvuYlU[s:/O]>V#Ncлedx9\olr6%BۭBLZlG5j#o{c2]24}>܍iSs,DQ19#e:J߶GUՔDTiHg"DoH@ Y}`D(7cse{WUEEO3W3R3{ NV1Q?q55ylZ6iN)jWTXraANBFh:Moqu4>@O_72K.ǖ'x킴@tЪe_gT_JB͔rENM! V/G]ʬuʨ WEU֪.5~i-bs^bcfWšESbs.勒Edڶ>v: JXjQ(i4,K$#i^%YI$zUUUUUT;.fͿld=hws[ǰf͑g32LS!bIXG4srq}}S#I_FY/wTt1y|y@.2ֵFj#Z֢#ZNo]R ѭ^UNHcVZѶW BcF`ys~>%Iz02_k(ca_^j}T}w3?mYmUc#=fr^m="WIzˬa"Wl$y75&*K$4/tSC#%F*{-s2ƽg5,j2 ˬ1ښW ]#c.s'߭#㑈TT@ i;6cx;ab*Xb?I^>PlZ0c(^XNhѦ~ɕ#$bq=.S!QU*.:w<̣N'LZ/uɘ~Pgt׻ݏ-֦w&~ ZO*\$츨UR]Ş{-2_bؑzFz(^=EX3עuX떑z:(B/-̪U|UU~UUM,<4HfWIeG+Y$*U5KI$I$eYds$=#ܪUUU^?3\}㤳Vvj{qWXZqY y9-:m"=a,~_*Ǐ2G|nf(V,Y?2norXtJnR3çEY;̓S>~~&{#)>?<.6ڏ[#5o,*~COǥ) XƯO[' /…xG󓒉",Ls̻ԗɕ\}UkASȟd.5QQQcFEEkG'ȥ(S9{q~w? :kSf/Yc R)#W+j%_vK'gt]+-2_Vˠk_7̞x||eYc{&!j=}'?F.ys#󢵮FW"Ms7@Lr#ЙYDEmN%5Ƚb㛧M6} ,cVᚖ{4mG#lAz/ajGOˆVK_Ù*nqwZ,&' R9? ez ƶXU$ec&-[$qὼe,PFfҕQ~V¿'•ll3}&@LNO//aOG9OİzrhZٙ7sZb¶E|HuZı1UʏV1zSR9n;=L; ncYEvfv"N׬܇:ρU1&;ٛ-ZDww# -u4 ZyTYS!.N^8ꈽWUH\<ⱗ39X|+=#^4_#y6sܾ b*Ë{wmr\úat]3 fRsV K{'y1*(䙼1?ra&wK1z$rd2ܿ|ryM8[nwMJg|?mDn>LWfٙ?͈Ł. (]+*3b>!ӎm7XbwT_o+uw}l::%w'UU-5 z8 =VWiʽUƹ竗wU} yNxߧ&F>51zifŬ\pFkV\>IY]/dUWh&}56%+pCnYRy]kW&EWMeG=VGI^N תfī /Uc#OXd˷\_vcINv˵* UN>wc;j헞y+̼M[덥iH2rmg_*v/u<ӡԽe)ӵiz/IsV7n,I$ҽK+,=UϒI{sUUяvkf򗳛ǖs٬ndɲLB|֯d/XYdz#ʽTח3l{7~W5S%f[ݳ*[[H*r"=s\*U^:y'~Z\~z;Kﵜ7V5>fƉR%_KYC9>`۸޵ytKmz52<˟Ub*v156 |5]I9[v[2Hm=9S<^Ź\c]ƵѨI`s>$OcUs>ʸH<ȵ<@q+_.-Mao믠IW i5l <ʾC~F+~~/TgulWXG:kfycy]mW6gl5m3f=35wM7گ4+*{FڪJ͆bu_fvUk'rC"$;~,~jc?y?B_?dᏉ?=r/S?D)DfS^!)Q*#(\k8xhَD,_R67ܛ}s~kٺⰳ;\72G"*{UcoW#U5Yw[S{{ykhաR1VK0"_j+3M~v|l솄&!p8?c;QjoE-cruU֬s"m;uX**I$#z5}~PgNw}DmtY~>Np*ͯ뱻96ΑϥEz|Ď}?uOc6"W߱ͱ̽5kS͌ܛsmF )fھ6ۛ^;a’Me9:j{)hCr7oRR'_UV(WDJc00 " S4{d5y+ڒ=~V_ty.ʻ_L}4iҵ{[$mj퇎rJ ezxAW?^o.y|ft7[qLj*9~i9,5uwq֖ꖑUUSˏG5Ȋ"TTTTT7ױ^x-ԞUmCkد;,34NtsC4nG5Uk p b^XWsA<22XfV#)XdH"Ȫ ^?2|*7[Ē2(,k#Gz5cUs|juS1z+g/a0xٌRKUBިjө5U~C܆g-r;o'[գ^KW.Yꍊj9r5U?j+j+""uU_[oaIY Vڋ)fs!h_ww'u=yy[>_i S]owֵs׫f]WStۓGq眳X u^~|n3>oFݩ׫ ꪽUdU.rͧug9̱(OKYIz% 'f݈p_b̞%rRe{<3)W6k9jRNNTd+^s]NƑv})g-E]}ێO"O+ IZlVS$l}rW\ o%L*ʮ~;'{=?[~:%d~{)װryy\vΚy]z#X&"5O 6}˽%ucfm93:qXŊuUx(c( 8׉mD$L!UNKפRԳ#>Oޙ/Emz%>j.QK 3b3X{Z=ct$`m9bWH}_cڊ*KUzwо=wɷɿjƜ->M{];+N)i r<2y[5<4E9PUs\*rWY-۵~՛׬ػv퉭ܹni,ڷj̎ś6&s=^Ur :zf<6*D%eKȝ|FW5~l> 've\nуw=ŘɥkgqVkd3l3cb2_akUcͅ WtvS3R קh]z26~Ļ&?cc9HײuRd:h߮JU6Ej5Dr+Z9{ /{[">йBW{7mZmss%O{VdU|"2T}gzqr9=VfSYܙO#QUjduؽUWHcu>¬ lW?5?XŽX}u> C{^W(< ka$? ?mzCqK9l;n?s'W |&ơL2~/E '~`Z~Q~`P~] {Oi>aXUۊ"ZĪ߈6d|U+$k'r5cuas9Q֢uU_C4OgcwsFns#QI",LĘvݶȤhqk^u_}_*/NG5&.^}H}HyuN [x#YAdhyh2tl*=a՟93xe~q?ٟ]Yqt?#zʞUlrs]2UcfJVA'_woH[`ȮK%4wX!UEXU"-zEDxYTF6Jf6w[:JVՕꊞf|Etk~r~'z\Eڎ~Ӕ`MҴ->7nKM?`>RB9zGk+jus}*z|;ԏ#+ Y$Q<Q 14)(B׊hZ &[~W=:*xct6hcnD5|md8B=k_{%m"Y[=r<|=˴GN6pU5 F) R:}=fĞiّH9g\ZȡcccSkS}ο:iSqQ VfTU_,)L*>6%{y:Yk._ {&oٖ^Y=2k1$}_On;i:IR; *(S_g;'VOƌ訝 ݿ4o^IHZWzgcs {kI%,"HߥfYv:"ؑɎr5+v!ޖZ>iy+VE[8mqG 7U:R+Pe$WvsTٻ ;3+ݽőձ%A*,SmZ넥aQ5kEtq^HߔJO4U:cE,~e*Tt>)uKD0jc?[)G1nT$B'e% "Inlp5ų2^ch>Z=?ɵ7G~+xSo(XRyXtdXXUk;zȿM= NN]#x[D27^VNFsoWGu[Naџ:&N) *MEih6+UdX2NDTS~O]c}7-2UzN5jXܞcncϯ pdzʒaOLXak\Ŝbfգ'lc rIƾ7,jy ,3؋lA"u%xD*X?̎%_YcXO߽LѾ z~tݻ\Ⱥ+{ur r=}Op KR&"9},f5|kHo".Q //;[ykS(T=SҫFlDU뼉^TXIjDH_{^, wEHć]`{qjo[ܮ]}OLSN1`VfN ܐ~d|~sST;dBN+!,M3ǘ^_ۺ},%#N B3$ARFj5:?ƿcǎ?tNH!sc}ɷܟ4rFԕˤOi]TKYNHޞEMs>Tcz^Uw#g8{MncP yG<6b(َId{\UUUꤟU** @Ӭl[<ы+iF75rXHO2.鍻wvvKc>9J!N<\u-h-݈F9.["}Z 7jS {XVtʬjq&fdkҲI6}1LVȭgְطoG]:)fD$-Tꈿ'[ׯȊ\:҂:*CzO,pQj}鹓Bq4OVJmoWhAayץF{#shڇz7S4+W5<0⡌ҋթZsܩsUYQ!8FƧFNDCGV} } jr+slyS(d2ȪR;qCz#|\;ru^<,9/t~\7s ܋ro:neR_m&Kq& ok.>'DlztNi0>r]d1kI{fmG9=éY|\D[2W-v1_X^=+~C\5b|d}5rm?_$ro8&(F<$&{گ\xW*v=_EJvep{Q8/Վ;ߏ0(O@%* ,.E~M"S,EOX{_G\^G~9+e0z>C+"Zv/-s?vB;֕:rd9{!WDKcbuLG!s_5|ȇZL=ע|>[ ;9W4I2lԭ?;ȭ1jXXO3^G7k|Wl>r-l} &5 +U0[3|EEйk8+!j{YmQ~ ^R$VͳbSM+V''XM=?Odz#닀Du\fə^Hdby"&{5@| ˼8=O=ofjt}kc-\գUF1$5r5@rg=_>&6U{ͥr/޾VYTC_#iX>ҝl[R{8-Z|( N3='|43ЦNVڧT4_%Լp=>EO3 )3rLjg g+jUoܻOe.Qĉ쥋+c/0rlN3 k;5,ʮWR7a>A4ʻ.d\1t%&Sdm\$ȭtDn/v7,*7w j08&\dێ96>#l﬩/!sܽb;R7.fpfuWo?r<9wu*\GpUQWLk_$fwWf-?"K.oT6݇hiaߴWo؜w5cOwmydUE<Ȉ"+-YMIYp:7+cTXӪ"/z@[gz'RM{f&Z܉mJ芉Z(Z>= NHDNO.~|ǻךxsnld㺌76o=?ǻ˨!^#iŤ^ra(d*WVxY#giU$N7sbMNOg޽hF_*"6ޛɸk?,ś},} )~!PyI+s@520n@s,w~NoMC򙟒') d_ A'OO ?z9H_=p, J}01 &vëj;6NukgtXXu_?E`}>=6R8?Wci\%b`GzԹWnEn 56$ºI:]lo{o؏N{>w!Sn+'&6sv;yD6_ ?.Aa{|=3,v7+UjB]蹬z~,K}<+Wtߵs|]%lcUJyEӪ9-6|(~ӱQɚ۱G$YlzAlqn؍lv o$nbY2)1ػRop[ Թ*ݕu>$hf,:юbO1iQ:M]OT}Vu)}||SuPfUBV>~o'} /_f9DݼҐ?&'2kD0W%x*[&B"|oa]ڰzѽ>~ ۿ}Ts63W[Ii8l]<:vd5TY#EEz+m[Wxn:{ž#!J);,=:KcnV*Xz>+ӏfY*qzj(R!F5+D#!6zo&] xKpU8]X[NJ=Ll6&,?ʮr\>:8~+1t:0:^ŘWs#*d_,UU'0^(X፱ƣZ]z!&ASq楿A|o?gȟsߊO*?hHp$;tu>hrl|U?'6>۫ɪ۫zĨ>29$wN5oV6+Dfo }Yɯ&5F &LKKU3z/ّKb74䊌3{2#)˸ո}nU6NZ#EW~ =|z`R퓱a!yߓv*Zz6#o!="4R5,Iud,.o{+k48-/3#cٽző>hJЍ)0aKpgpŧȚ.NDU:cNыT/rLkiٔec7{ܷوe*; r-5gHY#ǎ*/&.7ˣz"hvFݖbٸu^Z&255:9Q,/;ǧ_<#SBʒp.yojyR,!W~<\Z+ô_A<=!?(ӌk0$?Y7jӯo$6_?~6|2_ǜ9;Tbji7x|q0?6t~e |H>$LMxG6qlX1f:,gH\՚XnfWVlXE K+1jd7֟>\b |y ֵM_k7gU)gz)WouTٷ5C[4_iv[װ\_!aRxuY&='̒2&>Y69{ZƢU[~۬n{%̳\Uw/>>;آuUOSDCKW7')Chwvd$TM/-DW2Yc=DtLNh#Wǩ|;/~K:.ZǪ&V[JU;͗ɧ[卯Xc%9'oKezHλW9}u ֥Qsq܉Ͷ%Zfb9S0 I%s2Ff5]&.#zZk+U>=~M^3 s=:Y}\ $֚ 7WkծO"g;O~Zó/79[166ԲtZYjZ,9sdc\+q\g""hg"bX^J,E K^v2XƪqO vaE4nFV~e_KxG?{ u^O=[Uk.QUkZ"*HN4zv~j<RigexsܝOF%3a:(j.@o~E";fեqZi7_Th" cQ"/LFO3x~f~U*G>Թ㸧םrg-`p#a1E.GcKqG3ڮSXF=S"Icmݽrgu|ǜ8eo|cGs{.rlԵc Z{F֮k^+٧Rkb]ifw>Ssܿ3U_õ=g O|}vďV_8.:m]z<6+v,=1^&,em1tqMmb6ij}vŝnVf +22kj6' o8^~BZ29lFvQ TקE{Uϑ=꪿z{eUv riz)UXlm_/Vƈ_Cp~4 tzOI" 9s;)WY+ {W9rT&.wy$*)/=KUGSC6zغ$+-LlD'\9rGe_2yvN<=QJ )΄Uz?1ׯ/:xU_6|6%G}s֍&Vj<a99VI|iz2yU힚X 6Fq:r_h+ bt܄U{ҊJp_롫wɕar#yɶPS_qy% {xٵg)a(ڑ%Zon^] _r?b8s1ͽ&B<֡<-֢YF{\_cģen4.um6djD,SѰiڒj*:JK{Yo}2R4_Ia&8g,JfC ]U*͒V~)nxVs`ٶ_Y=wR\vðg1Pӣ=_,iay{kD($Q~޴3:s-";R8 ,fJ|䑯}kc|%<~<C^o6ɲmjkw5 }(tN\URşȶoZr֬O$vT#{dF֩*׹FiXoG'O29T Lc\εr4-5խvwr*+Q/TMlq:p T6֋B)FQI3e5sU:#7π)sIΪ3<ԏV;zxG/kY5镔vFĴb!ȾF6lv-da_h2ea_N?ōNve;IZiōr/ԞؗΨd#EE>fxȒzEcT>dTZ˜>|P7ukfoD^6mr~tڡWe%)mZ ⫒~B^ȹkaR%ӫEETT_R<)r?t=|uqJsXl>s"TEE^*o:*WznL6n _dY`; ;7aY$R4CO Wy\P)V+jda /oY̝_1<3?$ORiO Mh?G?rCp{yt7Y?!ҔabA`G|qn1#WЅ_kq\I]-ov Oh-[ːOgcNxr8i5^MNWjx!qXO;%ɵZ90X䠁Z X_!Q\7r닂5kQDkZֵֵ""x""TBj4kWFxjSRUVmjk!1j"""!zRիV֭^&A^xءbkccj5j#ZDDNDDDD""`Sq?'~w0?h/j?ucL_*})_^_Sb~3)H&CrYTk(زe\>5\$ls'g_e\'g6X}Fwl+!x&ԃ vnmnW- RBo;YX"v[Rø/&!v3dL6f2+W-,g$5 JѶrOoݠꟅO+zuj/T*l| s/\ԷC/=bWB@-~6RY$TnOCa%XgN{o >m^Pyp9ŕ{6O3Eojt^G/τ1$[|eǶY\LEhZzno='Ehy6}Vw_[ oS`a0}UwEa"*W$|q5;}Ubu2ȑPꞇ9[oWNxj؛-I'gsleU91y ? z;.A%/>?ǿOseY}BE_1[*|}_YBN%-s-_*E>$?JNjSzwwv'~Rd?Eqf 7Cm@um`s'K8t'jlMM7ߓ&"w_`o@?51<̡a/2vğ)"┢3T)vF_u.5F~yp[e?|>i*u)SRnGȽan9_gqpʍҢ$^ĿQdryOJP5P šܕ{ݕޱ}w|1/ʝ"迂2{U6ר-t-yN쩸>WY6~bnp3ebeX[%*IŁey޷|{ouT ܇O![rMreu#V)S)ŏeoz7߲ <^WuOL_\r l-'X$kl|NUwE5cʝV7r"8hW.M:,o\cVٞ/ U*{VkVX$la s1ݵ?&=7|1WVSY{9rz=jޛJRE|hqw+2Vz<\Lޟ0`iCX]ZyF';j2!-RgUezb7Vv}ú>JU7Jq2;O¾J~rXg~M7/AkaQM dD(PeNf$ s@ۗ~o`1${!\đ1B1!0D¹W߷ןJ*S/ۃڏ)w1ߖ&Vyȍ&BzD\n;s:/52EIo+\/!NkMCp]'1HPnF~b#ѻ![aiZlz [ :k[jp\GqqMTsǫr !NO54z&nFյaU~'ek~'Ӣ۝n\j%UQݧڊOnh7|3\S29+%&re9%FKmnup"5^>gDcvkvv+/ Z wp٭ֿk oN{DFq^nR=uF5'v)TBHYz*}~z!%+[T:~w,#%\dT_!:9!O* 8Q+V1zx-y3z^%dr42SD\׷ջQ^֩k`B2I1,+ر=fWb̲O{O7o{w@S7 X՜r_k&DOE.~j }r;$͛nn5bkȊ$OWsՉ&ZG9%rI#Yѽ<|x_l V컎RH붢㤭M!k[Sʶ4kUuNr~8IrUD /{z-OT0ٸzWihdݣx|C2NQ}4>)'ˍ_y/8lqRX`1="=R7Y4 g}DHtq͎W?5?XŽX}u> C{^W(< ka$? ?mzCqK9l;n?s'W |&ơL2~/E '~`Z~Q~`P~] {Oi>aXb#s` O31Df{ŏh"O߰x}Kjr¶&w:}VŸ"K؞K=R|ǻr]zCLUlrv~#aggŶ ˯b(;4[wQ${7lJ2\[t_,ӱAޒwxZϮwB{z$xNŽɂףE{x:nkN$wL$7\{D \fC+r}?^:5Zokzb!r>[2o- ߳d,_isۭFojY!XoFur*Ft-lJrkt0|%RO,pI,2(butHc*"}s׵ٟ2ocsB o3v v+F>/޳Q1<\'zXl>Sbb 9\w%G҉\e2vR)lܷ;#k\5EskZ*rDOLZι돥s<Y̞ ܏rxuNѰ]vAGi&QsopX=5m,#eRmvjZU܋_baʮEUOnSq-ۢJm!sv,0*Şݲ7?dG*UY㎦kToObk^:ER<R9WȄN}R럚ֈa՞ǿ"~US~*ڏb?Hx"OK5D F`<2'v6z̝ پ8;?^zMNu|ekҞpo$y͙f6UzDEʃU֋~0I}2p*5m$#*˛ȈEDwUN7u:c*"UH H~:ơBqٸE5ֳc' ]ݽ4x{qtf wSϝ=r.jwm;ٵtj~,cAqn4Z+|Gtn2w}܅,j9c&"1Ƣ'MNy.Pm1mGR;I0z_ v2\Ն}Luanr{'Y=cWe;c1= TVj+SM,C͙mؚK3##Q>f<>dC$q*.:jz:2K({E2%O~sr#Yxi{9ϸ%Fo"SU6h4V8Q${2i;: {3^rcGyYG7|iӴ9mrG?%2Vs`1cqDT<<}_:7P˞{j/ƵrPƬƭ\JV_3V7*tjRО]z8`I󞭇ŝo\^,)gSxr6\%ib_amuۇ.JƿO-> b5hej-5nؒI1W$b1TGLxl-<}&Og;+,DWI#꿁_TR78^7ZƣEEUĝT}9WO$ޫʮOX7d;[2Ů-47jO;cǵm&e8b[IFў,KJd-rncpV[XǕr9ZiZ,l/YXVR[q1&t*_f$WByקXQ<~NY춙q$lq1H#YmW_kQ\/CRg3Y[Pmd+ }(rTFG/"n3%SLPjO{!zFCZ:b͉\5r~FUj*DORoj+.|+UZ#^_Փ/2ߨ,u|+~M'5Y<ۂ-fqyFWeiڨܘJk36;U]Vv_;W9?UچiUV E^ekRJʶ[>gkbh"U꫱S[3JKz>Io̊9~^k×x;7 RQd1_]\C͑[YZ+d~ՑƋX/S.Ug91ɕE^`C#"{D{#ZZ'z_``a'KYSCKje3 Ѫ8_?M呫4s\ifFI` zULF?;z8Iqbv<Tf_S] Xc,(L M{6Ms;s+7!j?l󵐫ZY ]s̝wݟq>t~] D:ü8ң[i5ԫ -W*U]L=r⹫='sG$nX#FḀr"'x\UU"YFf:G+>7I:@-ɟuS|YgNjtݸ߭]\6쫷>w:j,ƜfyK(9QQ! LW؟"9ZGW;[u= ο۩,k#m"Ͽu{桫݉$^V},=_|Үկ>QuTإԂw(v6w*ʮ`JQ]9O$jBU?Ԣ^=@Laqavj}̘u/bCx0;~ɫeWƉE9ʩӧEI6iKPzsw9JG+޾Ʉ_"emLʼn!mya`HsIkQ|Q=X6V>-g*Z͸^תxDqDwrd1\vnk.m.Z=孮G^:̾hߊH14kh7l nD<~-r!]\]?4Ւm~(9;[m(Q;>>U^}?9{R[ZuOm~oo,)R^G۰XewϹq58Qk8.D1&r9+;iqaO SU(+;v+?(!f4v~;,M]N֕Ⱦc2G"|yyKnS |4JFe޴ܦb5koLv=\:ө'^,#>T\) \=Y{Aœ/5VOu!ț.>Dr^qW'jrW7㴛osxN6jy~<[Yct};MU,c-8hTEd:IPX౐z*-uJz|>G™\?wwoIc'hAS[ ' W8k_ߟaq:c\y65f~H'!~()>?<.6ڏ[#5o,*~COǥ) S c0Q}Jzl^Q4cwU_A۾ݿs<.˕46d.c\Ypg q&<.qq`)+I$tM{ѭʝT}q7]㙈8Qt}SC^ձ0z&=Х9T&APDXፑ1Qj5;d#C䡪]s(o_saUOzώ"36Im^{_ fX_5Xrvŭ蟂SOՖqf45gE_H|>t_zvg춉ۃs=ȱ)Z?+ӟ9T'ZV/ЃId\">~ڑXqGUrC-W1Q$zyU:D?{W'Xy?{.9x~M?5- y=DnUźiP> GDk0%yfb.~4_,Y,k\zU:x}S2O{5VQan{'sUk#Z^ r9ͱ,, 5kZoU'EVP虠C 6][7Ֆz5.E_ېWu(+X{6V|+q.n nʰSʺ7%rtPѧZ*KO`ק/B{.;7^\!qV-=mIjZ쵶:jdQTqSص:J~S,.}~D$W$B2F|RױUkEk訾(-{{ aX|YYleidq VYw܁Kk㑊"**x̎%ee72{}T8Q0q7ڛ>aJZ82dZ7tEwY{Z]KwusqMy˒#Jlۣk Ghm1U>܈C({Vް7TĨjT|_WيN0k={kG5rts\kz*/uoQsW!UF J+q>w*dYf #{\DZʊuԫ~7WJy\nUVnk5k➼=Z9j**)Q|QQ~TTIc≮bmH)uUOj,sc(_KE{)Z ]ywwg7_4F|;' {iwvkL|Rtwc1 l1UZbTDUV/^Fbt';FG:wcGueEZ;F;SWKp3Ɠҽ׻2R:Kؾ@jzfq=\ :4#5,s{QX듊~NZ|͓}~u}~∬*a6 &]}$zr=Zzpiؘ,f$/Bޟ牝u}l.;Eo~ToGڑ?~zӱ*׃O/^Zu=ư_2wrBK)|߸{_ \q}aM3KKw*ƪK7**\uIRW4^E#O|Ik·%١}늺mӧgAse clYIz|FS-Z<͕x!XܴlBX5UƻI'+pww[Zwktrs##ͩnVE>\ԕ־ Y|$}_|jXSy9ڥNFZt؆h)'#b3܈GW;5ropl܇{ǚ>IYqRd=|D2_R/j-LMc=rՀ<-Vev-)W D_+_<^rE8bjI^j|{܍j}qw a Ttx0UWtT~{%PE:j?u\8kv_?I%^np1$LPxHL_>U{ҊJp_롫wɕar#yɶP;~Ea2zu6z^y=J9{XK_潃\t{gjit/Ejtr5՗5ഭ7)]Moi y"fvVjUv+ay\~EluEo4q [6W.ק-dF_O3,,n0{lzvp{.\ʊ'V'EV:;'Oσܻ~tO1|%k [-Җ6%TTjcTD豞[_eSkW"I'wD_q>fa3@&ΚFe隔1iM{c{Q|kD|#Z#+/MN.o&Z7zpopuȵ250jpȋ 4 vSg9:G48GĽ\PCUs\*rWa۵~՛׬ػv퉭ܹni,ڷj̎ś6&s=^UrkXcgS\:<@$? ]-I+db^-ejx,]L+>5~׭oݟv݆7{v-vkD}mØ̑xFs8F+"kZ!\ 1V5wOg =?Pm6yջW;x,$r1W>ˉ(tt>:~BϕWP+@ +Mw;&z+;;rIK5wYbDWϤfon]qc+wme6{⨹1MϙXoZ5anC#HW82wW0~v,z̘; mc憆7l8 ^Y-TH[V!m,_trOl;~d^oߧI3"+Pgk):OGF,һ6~"uT'O0q1t[W6r?qF:x=YLL 6͘+߱K;W 1x=U[:V1+#[OK̋s!npOO^mvś-zɱ~S3D!9 @H=)tև߾~߯G)+T?C%aS~=)Of/Os7+NbkVgۖ7`t1¯o|i}'W4ժdԜ.Fblkte=_ $^dS6Cc]cS m:]io"GV9HSr*4vTSES㛖TDI;ԖHQHe|hGI'NGS&I>I=HH$MձHugUS#ʤ޿/؅/: ~Uwnoegҷn ]w*'T~eYehu)_}.L7FMK#!b84.2Ɏr'~??RWRew GDk0%㷟ѦO2*u7>S(L?^I/Yϳ=hs,lö|*YgYUŐ5W΋ӫQuY>ػpb~;ssq_qY>|4̮L[2lpbk2\ "N<sx4/qy ꪵx1徐ҶpO#0rƏ%ۈu[K^_ٿ_HSsr"}GVʸl{U=Kvb*DƯFU& GSeh'ҒG~Y^StolqohĽpwgKi:9$%]eX bc!~9:Mœۏqn'.:;U)=Rck%bvDuv$|\Z*u|Bc*rꧤOBlK[{?ZT |H߿ǿ7Od+4 6ipoځ Ó_ q>NN8ؚoC&MD$22"$;~,~jc?y?B_?dᏉ?=r/S?D)DfS^!) _J:Vt7m`opcU#=ʎD_fߗٟevcGlxc_t*/oumySlP܎&9S Q|ƶ,^}Osػ֧vOf35Fdbz{3]r};r0*/R 3)2q#0un[_"[ygUl>UHjyCaƙ .b[iS9YկBJY5I;cڿU>EEEO8D8 D7\ ƣ Zc(TNF* wO9sF=sU5U{PvoeJ\{})iYdn&[]][}c-KgÃ铔'G6ҩ Mw1Qؽ&J2IVv1f:Ix;)bcR:g#gD譤'O+t_g#`90@ -?8V'I܁_۷/~&|cI*/vC"bcB`?r=ocum?>Tf_S] Xc,(L M%/7_.=ċ~F:?~W\U.s>@.#㑰U'jmĤNC+DSUܸhʉln񕁝Wʞh"T_ {,-)6G'߲%(dԊk%-*j2NoI2yVQV:>3#M.N+a3 A|F@GxvѭtoO3\ ì{9b?eo'ubXx|Nݕ6g9>,ߕ+){7'=i;WnۏoXKVä:RWkVpD|YzA3ŲF  afV6bj[?2*915<Y_,f9 csڻܰc9]ҾɄ[~ k<1aLMr_JyLe*ϊ᮲;T.NQ"kCr +X$V\1_j)C܃Y"̓5$u2> 9S_"'U/ދխ;!ܯT6.h9Fhq 4/I iiG i[tl%jלbsVQNU]~[vGdSrlYl7NJ8Ֆ\m&9R:'VնHg ڤxD+^Rq2+='/v?d __7IdX@nwLib+/cѣyG'#oY'DUKzlzXwo̕8ה9e~&ˑwl",vs)$lΊa?;`8?SpX5~߹O;u892|QKU&VcG4zXUhʊw"0~wjxJ4Nn7K,lK"*{I:*qFhV7\kuu۟/nu8#*Zsv< ZܽCY6+긺wҞ.Z'`'uX岶++Uj䝪(e2E#c!{Ю})lKfs@9QLO<#SkSUz@k?,ś},} )~!PyI+s@520n@s,w~NoMC򙟒') d_ A'OO ?z9H_=p, J}01 / g|WDNJUX?-gH势9r>S'm=V߹̟v\Ucdlĭ=b虹'68! {kl}ɖMmj_#Z\rԬd{Q&ƣW S$ʿ?O NS(B$P/#g4_B0?ïG.$޿/e/u*}uY-R'*윏>ed1xnSy;zgm}Sulū[ ҵj}eyc둵U͍vm^ة$OiU LԵk,]@^^I#Q-Z C1Ư4ލsczyʳ]j,E'_c>EK_.oh_Y{?'u\7-JZ?$l\!I-2ؽl!SrEvd0}\FO孏5 6}@䱴r-c2UFNyQU1EG1r#9DTTTE%O9pw){s~& vޭdtr,Aw]+tnՖ.eHETj*\]11Ϥo0/ݻv|\6YhA;+dW[ub, +Ci$K7lܹcc'WW tp\s17dFr-EOb]S6X[5X54xLsI8{Ofoar:G<<|oUV5.\@ sgWʑd8޷] 쟔q?@cY&.[P6|!+<)ڧSMwɿWCXoLg1qt8'(XKG̝1'@gH( k%8%,O#!6 Hcz'W9ȇyd״_c3yNy=-߯ck{G^Z&yUp8<ϜkX 3e3Wk=#\:w1 U}5{"r5O\舟]UK؈8,NLm U,q5'o3ށomgvѸkfo;TjEjmjtjmw|l?cu=.[05Zܮ_ß[7TDEÕ$YVϒc~jywU*ph U|gOx,T*qy)z+aU\o+,^g*ܿ".<~\grXx57;' fz>)1_]usI^G5iVޮ~:'ͅ{ѱ GF/j= g3ֵnL+XpkbW9 &Hw=/)W5:*zWuB| ܽ)]zI򪷪dՓC'N{rxퟞ{Eͣ{ݳ9[OݏZ$fo ~'Ou|@(eq_=ybz<\#t Z͒֙$[ BR+}8e{jا3ᕋ>g5~G1~eNHS@q_;W٪%GGk+1ӳZE^*|c3/A?';tBv\w=,jsS/ k$fHrB +.'H?Aמs:qjM#)KO=qjX˙gi9k.6ǽdH~ i̷c,|O\'W1 1(cc(Glj5Ƣ5cQ X<Yo׵{0<}LNԆ+Pn/Fpׯ l1DLqX^6 Tx^:tn>pԣRE 11Dj"1kZj#ZFDF=C~[ߣ0qO\5Ϲn^5M9kU_sDDŽ{U럛 _{~߮Ǿ^}(N̿nj?t~XQ["7e Sq}\𷔷wQ"7?@|o\?kzN|ܬʋ5u5Nj6yTnUYS7L CRf0܄:/Gq_[lȾ r⢧ʾ>zttKҭ?,I/O1?%"n8+FQZ܍OˑELI%~7U";{}uݢb(4cx'V{i,+|[uG=:=I*x3֍RGj[NHQnPC7F1mtS,eG9>μӢr9>Yzt'e25KKҶ>tT,utk:E{ѽ:!'{/^˫h#;)nHc>F2-ԱW9@^JBJۼo۱rwx%tFwDO ̻q\|(n;ÐSd{ֵtUEQDJkXcgS\:<@yMv?(ͮ+9g6,1>ldDDFGz&"UU^D5_^G\OkS/w%zqbyhƲ7gx"k^#,u,Jٲ5 ,uk;~K =xju\|.jؗȏTdVG\_ӷz>{;aْio}s~Bj=}fI=d{] yllC6DVKTcD=WzԯZѶ:2(acc6'1QiZizhx~:J5LK+\5\ML@rÏb(C^u_,qu"b) s3HގcEEEECٵkusz`Ofz͉v .Jdp.VnW+IZ*p8= l6'bs-bx:_ ޅr6((\#,3FcEE|{\ǵcZsWQ^HmpYWs[o_2{]ciy cQ:64C/Q״~[%7rIXnl4{7^-!fo;g)i LD,TaMۇ4^]vջ_{Iޥgi\ǬLuxfӠ{ck1llL өWKFE"%E}e_u~'̄6W901|-aoD\>U|L0}6N|iW5;ݲKxr5k5}ZWF\kZe=TsODR~l_/ۮZ';"r.,k-?:-j俅oxuo1QWQ?*.F~*B_Xb &3 Tdk>On{oچѣ촺潸`2rikq9 hӣQP˪fZ|L^pZI!_oWrB/+ܭV> QҶLN#j7"YZM<஻gUj}ˁvU+ud}#+bz͍6) (Wd#UQ~[t!.ڹ[o&vɵz΃}@ UcZEE= Ov<ȼ~ycOޓS2 z'bqR9~E[=wsaj}i =: ('2UCgn]eV?C\6ֵ]&/T%^~nm{\1'FK[']N5V+50uXSW㴾2s"z/֒eD_F8f+?J PuأETDs:+}'U_US9;^{{x'xVᴽOgE Vw[V4d_w#rKM[K",")= /8_Pcc$ Iy{Ůvn^M,Ur5V&^&C?ڍO_WN8s+,G~G|f,>K:v?_ij+j5| L6|!ۥ67>[ǓcPgBr?"{?0Sg}^R0Wno?s\?K=§4zRL0_,1=c+FTc19,~RkLmع~էR~k%k; 72q#n5!okW-K45OTDW*5"'Ϋ\f ˍS? _rΪod#}v۟nXfBpqS%cFpgTZ mM"YsU\mˉ1 16Vǭ|HKSjz3 ro27)>?+~1:'qFd& G6 #S.cVT֩ ya5jxyb6tO5 CxVZ΁zNMcS`1#b#Q<wNq.: ӵֵױq#XN< lѱj}FO!EF}N}R럚ֈa՞ǿ"~US~*ڏb?Hx"OK5D '~?ϟp)WjI _u_oaZϗsPgٞ4{+d2H{Ǣ{1^ylN+?೸~k pjU8+#ZJy fOr9_ߩ3X"UGcr)1YJvaWl}jOTz7=It幋WR ˀ;(d"yE+06�Urx zbZ$d.յNUiCf {k7=߸=gUpݢfkYO=S{=JBF3pƩ8=rri݋xG$NVKr|cQȊp Dm;ia9+k>*~?'ʛ:gR_:5vΜ{?sݨi핾߹kpM{~ݮ3޲9Z*UvWso<=jh)|޹eL.f{F/3QN*wU=֜F+b>I3"F\V)|rkY/EG6&9U?"){ZkQؼV ~lg+ kbeQ$ 5~A5lyz9#vegܻZ\3Cvnr"b3qg'd*Wcc[ J㤅`C'G6/inUl9ݫW/֒eDFtj/R8l^X=P ~Y$z4soqV{hm7[kĥ^[rdggfز+]o'o!mie< Ýq/10mru)V,ȍK,ٟ>O;E~.Yry#kӉVߑNW/UUOL9<ȵ<@q+_.-Mao믠IW i5l ,ߛi/̟݁?/}Ҝq54ʇ~LIe|d+mgUtʮw֣VUDUo_#' "ӟQ7gm$6-}z[r' aSeם,E% mZmF݇dݳwD7:-sbom-o8I#Wlqbcl3:7Q{+p6TNGX~xoG7>EJm{|Utru\2^;(evgʐΩ"~ 5vܮu:ԖZ\%'O1z/G }e/S:VlRm S):1j9 3uh:FͰͣ3ZToru3VI"kd%FUEXZ/#QU,R'dGұA"9=[h&3ף!7+68~RӶ=CUu]t2{f`{{#/T0z2$ qOo]vM/S_Եџ?P븛dSGӹ[> [KvI1ܭm\9gtsDN}| +dZ%d&}g+_Tȍu|R2kX|d.TYz|G*CLkVtWn~WȚuO5:i#Gdz*uoo~OWY ~ tBY."J#,5恓R}9\{'[nCܯ9V-|իHKZ/-6 Oty KenW5cVC_-$D7'=UQ~w+t&}"&(GP`7X'kr nܼkts5$ܿ-$ '?7ʿ]}QR~~N t5c2.Do96~yvHz?}U?{rve^>jroX$?~Vׯڧgc`LDK>w?ߕwPtesNf,vi}ە)ݘ+Gs؛z_xBr%`>hXw2M?ױڬ|O䷑gHW*uEKб*fcÓ!)ᩫkw%sU'TrE,q7RHT1G^ءFj1DN=c\iֽk#հxs F28b0+1"dL6GZV1ֵDOo6 ְxms Y'TduqpУZ6FFAVOֱѬj5C=c%7;Pf69o ,R%N˯NyYt^8fBqVLNͻlqKZP&!| g6#x+<~_#\4/}Ʈy5}?`1;5}#dG1RU󵨋|QnpOO^mvś-zɱ~S3D!9 @H=)tև߾~߯G)+T?C%aS~=)Of/a'5)+:'NOk7 E?`Wny VK6,tlduN0˷v}={Ym'R}0>he}u)X"hY&)Tt6Zň {WT[Q=YWߵ\@݌m;'hK9vG0?Q/Kfd7j)5jʞf/^ۚ6AȩRлg>M͹ZrZ_#ګ$~x_yV!ꍚܒX[zKq\Mٞ< nqշy뽞9z.+-ARFΨVEP|9Q,EOYLI`0N?5- y=DnUźiP> GDk0%㷟ѦO2*u7>S(L?^I/Yϳ=hSA,V!xc6JTc_T5 Oxˁu}woN|] 13=a\vZr9kؒ>_#ߑʋwkIp]+9tX]%,k= gUj>EScG'>sv='9ʪ;Arʪ]UUJkb9;r.{I_4.^ۇ[jĮWK=3M<9zrWRFgw\+j6&UKNN8ؚoC&MD$22"$;~,~jc?y?B_?dᏉ?=r/S?D)DfS^!)(3g[SZOuWS>wWZ\oۆ;Xctz"}|) ù +8CRt_\Ȕ<ʈQ芫ìqSHF,c 6a7]wt궩VzU'_Im=r^>Mk͎Asϲ"x{;Me^IJ˂K~B,n\{li3xϓ7O2Gx%jx^ U~_iotu9װOQ/ag_XsCa֥NUUյOؘ^T&ŜcŴeh|s|vk8}M'tOsj<qI(hzFЗij:[/j2/i[ J/lDFjDb8:Eqԍb~d(GP`7X'kr nܼkts5$ܿ-$ '?7ʿ]}QR~~N t5c2.Do96un.UTEOn^_ OG smq#K F {?%Kʩ^V4E#ʍȬFvrnya3%^:n!^ƾ:kr C#cG3{I:HDToZJmO>jF^?kI:cXp׎){TG"fjZsWEmQUQ[Yz]K>ޞzlGj^8ߐ-֙ t)qIܵv ٖ('-M!5W{V*Tc GH{0$!zFb RjmyyS2y#XdUUj5pq{l9/KQȩRf 7SH ?眿m1lwXؑy{ԫR~2~m۶:gv : "y+[j?nqZz|Ub4 bW d?:Ͽ,?uTy~CnqOe#TTUȑFN4.Trx=^ooRM.۽R{sv.h&4/5q^ѩݵ㚭Ѱe1Y^xMKiS¯#9tWѽz9ޞxf/EG.SJN*wMsW/>t(]rVUXarR6Fau r}HUdnlGfCӚפp@2Ni$rdPƋr*˶wuN6]}׻NYH#tiw33k)[Lq EƊxߌE{a[-oXqE\eW/T|sꋵJ]M9-k|m-}I|/Ӊ2y2deɤ#[c2WVh5+,G~G|f,>K:v?_ij+j5| L6|!ۥ67>[ǓcPgBr?"{?0Sg}^R0Wno?s\?K=§4zRL0_, ~WQ}Y;̡~~-}c]J:rs/p9Xs "ע-N?r4׶']/\ TwIşUh-EES^Ṉ?V_ꍃn+ll6&K9vG0?Q/Kfdp]_xR8읤_=e:s2iGtn^]:w>o:DXD*H%:5XȿCΩ}߇Nnf$^;`X$*{TEG՛ҳ>z2OD,IY[bY6@ s/\ԷC/=bWB@-~6RY$OF?^|9OU2OZt>@z|# '|뚅d>IK[{?ZT |H߿ǿ7Od+4 6ipoځ Ó_ q>NN8ؚoC&MD$22"$;~,~jc?y?B_?dᏉ?=r/S?D)DfS^!)Ŧ7r+=礙+kB=װgfBV(ƨDVH{\?WrH.[*,.lΈydlkfV*yV^r3y}IZϫ([ 76r:^}ƎR_%. ݝS'^@'yLN77JlvZN$vy?9U׵Z*)${;m;Gxo4_<uۆJ]{bJObF$fk]#&/O l>Y"e=H[/cl>B6{pI^fuXk]U<E02gcq!:vտ jNڶ5m<>-U#Qsj!_F˕3YU[ӢG78ʳӛ﫹5{,K.eۘLT^v,{zqK:v?_ij+j5| L6|!ۥ67>[ǓcPgBr?"{?0Sg}^R0Wno?s\?K=§4zRL0_, Ҳ;7Uץ~|:u4Y|,[!h k'aҵՋtM;<:GsMݳql|۟+Yx8׏+5;3kYv*Y绫Ozp{Jtz}XkU~ NQo?~o>2Op>ݹx6kIW~[?I#=WO~oa<+~iy;2=ҜjsaGeoǘ\rm'nyQ~ř9[6d,2%訊>_HWSgw)dQWla1ѹc0Ryx~ _\r&Q-_]磝jWlت\ȰU]k^D^HS"QoZ:ujLoBſ 7<v[ϵ-+z|""_g!AQQWůV@N2'E+)ܶ5OxN;֞JM CfO",2cu p+vz/Eɻf[W7 kfk=J!*Oi9-kٍΊdzK:lB~bl3&hj}:e~W9DDJgGz+ۿ3rd8M6Zl.CiFr"ncE {{W9rr^>@*?A?VT>}NO#/rxlNjvidaNV\]உ5]?E ~F_8uXq<뻋0,_jVx~C̺W9YZ_jF+cjFA{xO2=Q:Vh G9<:-[P>ܖxjh(>Ҷ6+-۫IδM]P޵}~Dc'F x*Rg*%;M^!Nwjh[O[uX,r{,7?Տןl7DZFΖXبUoGuG7tz*fO,TUm۫]S3'y~Ho+lr./$sOnMw]t'\S}iXm^Vz(7X|U kHjW6'DW=cSusO7-(ɓq\l.d2תlPKw%:Y\j+\DOq-.dmJnm}2E $F|Uz!FW*5>"~O.m_X TrRl8=:joN)w#ܻR|WJ͛UVܮQYzV;'E${5g=?p>;rБXб+"MIg-±96Wx)ul)xU> ^,޸^Z2d.z4:6Zlt~nuED^~dzȥNnW{fW}4]Ms:NQPnwc)r۫e?Wa/[_[)N[r,6Y=V̶79z7!h{︿E^8;KmwoC/ع'a]f6yw,qX5T\Q-*B=-Sfmƙ}v۶nGyAo|6zMq،es,u\ԂILsX8Kz?Gb'J-,h:kU~O:`j0%`? ?mzCqK9l;n?s'W |&ơL2~/E '~`Z~Q~`P~] {Oi>aXI|]"NLHCӟt9b"Ⱦb*s}YXLh5OV[دL>;dIlYfaݶǧlu٬H"ޟ"c)X&^ﳉ+;Iڶ;J~ p/G"ȝ>E#!?{)V6c_.oh_Y{?'u\7-JZ?$l\!I-ڳ2*}6k1|&KN|zC6O~oRϵ= 8pŲ%y=ceѪs:|,8wϹWO>Tu2\. ؚsU}r,g})9~W+٘ghL>^F|k=F:D*"xdj62yV6ZY hcdLuvZ^֢ȊDT^GRk+1krjT{cka]#ѨTꪉ󟊨ꪈDOS˛=38_mG|Uގ! Kіvv맭[Me6lM}k{#)Ιmib#wG"OPlv马ɴ kK^jN*he綴ɑX9UF;W}ʑft^&_<72?u:sSSٶȮEu$FwՋZLfG{c#c݇\W9kYj7,L'E> J,`x$N;K69eM#l7y$]]|1 bsb͒*{ TW#h^:/E#U9_\H|= 6EPe#rλm4p3b2v>TW{(_b+эszznc)zz "r%d-8To]w\ET\r5<>rUN韠_I?Ԉ?_Fxޙÿ`5zG韠_I?ԇ_;azdgTrqlkƜF**k§E!_I$z@l1O5Q.+DrN7Xs|A7=>WױU1>喟z a{cze87̋9Ka>WF5W&Fңԃy3o2W`ZvRRso{*7zER~z:wp|r fոNs\'dhuu۲VҚý9:A ~rPO}swtڇwcۦlZO_d2{r>L/Z]"(Ֆg{ OZO/=X] %b26X9RhQQ9ײJ+K@~od? _Hlv2h>l ds9Jrw*2o!'q&cS`~//m> s'h |I!} )J#5B NDz}VVk5Ta#`kSohp쇆eA0[ Ou[FZCUrykjs[Uޏja%o{w،>n cg%Uנ+k_2U;}#FRKp5~jz|\t2m|'֞:VͺVy⇢9|UoDUO@w(qɥ9Ec {$۶+۰*39 M6Ftk_** l{2Y6Rc(fLJl̕+w*qOaR69z#T?FΞ?MoTTfzox0y1ʫӢ;azzz7gz!! =[>[vOk2t +KS~;['ϳŸt'|ѾTwEw:|uߑdz6t|oN'^NBMGmꪧ_oN.gԓYI~tzQVVЪ/+Qjv2YI!lv+89]5XGDcsDjj 8EQFNO޵ʝNF+BD^&~y^G|Pd8W74"Q ='Oĕ^"^KGiiGedn_+ӫQ/a_O^'Z韠_I?ԏ/_Fxޙÿ`5zG韠_I?ԇ_;azdgTrqlkƝ#Smur''U:#Z]U S֓R[ hoVIU{ҊJp_롫wɕar#yɶP3|fur=f%WN4^=O(Lpqsl?=\>EG{g9s=Evhjq= M?utr2Xmꊬt DT\},]m^'.R}-,IM18QI"9TUbEO24fu$:ק2Mh$KYb{W悭6UO2\V?29~!bOEl:թqэ'ۏ4v٫Hs:r"BkXcgS\:<@U|>UU9R<i(b%GYqr""uSI#9&FELt#㍍W>IFj*" !LaCdBAYoN-Z=?}Rݜ/C=٬eyUf }|y>׻E;{ڭjP_!3\ݧr5|cN߶Fv.õF:75ZhsUy2}TXITlu:5쌴k~g.j½"kqwatu.q.ȿF[bZDqʝS?yKY]<LS5t^4]w2I5UqVw"|FI>OquH>FwDO {ƻŸYjzk.pםp/X:5rBܧkb-# VwVTF,Ǖ$ãվT@Z䙭{F]욭Po |Lޣj ^&F89cw-ƅ>I9"}U#oWyw,mHp,"X+}v4_4OJz䟈֣v.C f[ǓcPgBr?"{?0Sg}^R0Wno?s\?K=§4zRL0_, kjt徢n0(_ODŽ99(7,T܏!]gs+5zܿ{a`aK*[ݯ.'wTl|et?<ѿ*bh)ϸ]sR 7ڳO깊o__Q [ д$IIfC[P]~+H}}^-2Wnps\߮FG兿kE_/ zx'$sX5{kƢskQ:!5s浍jrZֵ:rDj"x!lazGC5zծl-Iͽϥ얠Wն}j4x*5W9E(=C{ޭʽVO~x YbEWM3ZMUDU<le^=r|tخƇO̕d:V=ab)hU~n毋cnDٙR^+:&Ŗ ޯE"#厜5lR*#V<(zlhKf;'b6qOM;Zemr_-QҢ#ei֯Ɵpٺŕ*U ofk?ޢׯS}i]ᚏ}G1նN]cΫ"I8*~FD_[>+=*Ń9rӎ][Xr/OT&~jt?Gu~,J1Fz3M"x9:[/[bEɼ%4}o.Ko&f1[7|=QIa#%tƭY[%og0}GHcdxFVҎ5tLEb#w,RUGY;}r$^GʋNEz弹+6Oyf>HױZkO{2{6xArYeZ_a:G=rQ~m>ݹ7D3{F]:x푱AkE{&N3-Uzry왹z_&EOXb5gmn=gT/~FWtkaX֣(c|,Iw̎J7r<ØƋm\e\up[_06 M3|SklW{9/%ImWkfJYz8DkQI_3̩EDN,N<3O4>Gx*)7`v}d=dQb_2 dbF3_;!:W_7E-Y_mQC_fp?;ƣSL۽uE=囧ans!ZdE))/DuȮ=/ʋ>mMj9'^n4=dV,rF Jb梶DTP)30ܷ3N &V#E ߃?ddz/˶ C*_2UBUkͷkoʫIkӧ@\yO.)uyrh.YxW1}6PҪ,lcXΞFGw5OntX6^8dTV5gF"yg2 #m:yf['k_7UFQWJjŠN{zqᆲE4r m*`%8%͆HilnVUB9wW.͜]7,H`}XwlͿ3#jcr<P>թ?Y'H᜿1 g\_>U{ҊJp_롫wɕar#yɶPl٬O+QQ,GtG#^9QSE5We튌v"q[dqڊW+nxg F=G"rjm&n&c?֎Xdl[)&69{UYTO7)ãz>dq*Ĵ|AFH >g~S3oV-O {baX֮+#cѯIs3Ȩ10dOgwίK )S&z&^Dzaa!:=hW_ z׏csWl|o#zdț#d#] G=UkztrQ*?A?VT>}NO#/=5u?oK;]m׬tNV/QouvIJ{=Q<5~ Gc|7ēb{]棊֗{cժ?p]q܊m\,+:4 ?=1Z7[Тmۆȩ[zBPfyc24e5_Z="|谳~4h݌q 7j fk3klLKRZһ5WKkލl\C>/!yB[{`h$ry`]v;I:*fF.^{N_\~J!7ʱڭOݧƖx$xj"t.Mpq5,Qc]z+7,9gpO!X*7Q7N]lm\|S"^smE֢u,}}w[bԽwSϼZ͝pʛŪs#O~WtsG9Ul̝C4$็*JӐvlֽYZkV.U"ZתXv_ybt_+*xRO'P L6|!ۥ67>[ǓcPgBr?"{?0Sg}^R0Wno?s\?K=§4zRL0_, kjt徢n0(_ODŽ99(7,T܏!]gs+5zܿ{a`aK*[ݯ.'wTl|et?<ѿ*bh)ϸ]sR 7ڳO깊o__Q [ д$IIfC[P]~+H}}^-2Wnps\߮FG兿kE_/ 5ygTg!ejFXj1]jo8=@{&6C~x_}oq1o EU[||'qOẘS_>wke>JkmXF̓)Ksq:x6_Iը {*u|JpZ%|x\~G7#UQRz|'l>_`iWt`<[&C sguyLʻV: K7^Lr'WGgOΝUFǸ1&Ve|AANMW+o_I*CVL|]R3r|^_sJ|<31ɎĽQVm/{ؙLsU9)L!6VM镥W#i~ WrY?~%PnMu\Yvi4B ml+s`li,yIj(oGtrCvRaQ7$|vơ,rFǛ}er r6oX}t+yҼhQD,|}q;׸NcݒYd~Vr]eYh˕NW?J0DY{gNm32#{W!l ^:H!z|֩}}݉ ^O|RML ,ߛi/̟݁?/}Ҝq54ʇ~LIe|dI1u/ߣk%S^[w߱ JTŒ{6X|pW mW=r5NTj*QDDOUWYX0^vM!ep\/Fʏ!DvOa]bŨ$lVm:&RWalY=gMT%g1/_FLls3Kهe8wDs[IFƷGZH'kSKc~{2rolR4n\M}G1bGun*9<:'CVx*HRKOb*ܷ&~N3lVkntcwď#ܛwpiu}k^ٌIKs9[Ӣ'g+Q>l޸^U=kXp\#C ^m]W[$oN1:Us6z|-_FIz%vYnw~ k3I<I\K0o\<۹3zܹk9_g޶|ݰ{\/d2V\^Եۺ[jǽ6r{mevLէ*rw/NrdI\G]#/޹ʪ\d=WO~oa<+~iy;2=ҜjsaGeoǘ\rm'k@9\*˷651,M*Lr_ZW1:uG~@Cw}8}a^͖fiʨ֢L}ݯYE_ܩrge|G 5>?f_/;«n}۲^ϵ?-5>Wa^[Ļ74?kdORqp*?A?VT>}NO#/tr9Lv"e/TՍ=TE_*:G7_ G|>NxrV݃$PtVn6d2[V$ȣ{܍Yq|<^90qֶ̑MdkX|q>T^VfL*EZibgllsxgh[G iWW*u_$6>q$+9 fO6?uk'^/N-aw{Ok^-6xk$w6s%Y"L.k=Ohw;V2:k܆_Aݕ[\cqOdi-Kym`g25ۚ;a;۝:R\zx{GuY\+ T.o;;QxTuyWZ-{ȎOGJ_!=IޭIddkU-*jfަS+٪kt{g#mu w,+pڂW9൵d9') :G46r{|ȐXB˗׍|=TXSEY>|t9{ܮ{s/UsUs~UR~ꊩnmvTTEtR~>lW'y6o,5S+_ٿdohOfH*"'+VnhdvoIzE+_$#󪧑#ztD_7Dnwj]ju;q:uzxbfTE/'T&?,(P;u4prQddS?h,lW'>Dq(|ƳwUcVVG¹cd9]кF5QbxOFwbcΉ7WiDO_?p>Qֲ[7=߫G#쵟gu(J_>sWye.~_l/1qdV?ʫ^/k>5O,K/?Mҿ_'۷%w':ﱟc>۽Ƕeo=^hN"Hs#8'_S' _o6t;~~b͇ dᏖ=q?)"␜OHDOkCoj?qoף*ۃ롿w ? 3 q%bl;?oۇ&h ?S1NJ&,gzeG/#g4_B0?ïG.$޿/e/u 7kv=Dn?/q(_O;>(4oua)1 s/\ԷC/=bWB@-~6RY$Tnߢ| xR3<&?ouqףL>ۃ77론ao=W:f; ϹVHfWz"+3x'^ϗy8Fo9a<93oelZ|KEg's9CwSoiib$t0KۥI,nHG:1_i<~WTNI=5g k;7ҡkS7YvA7nͱZ-s8Bl$mF: z*7aOrL#~&.8rmf=qMK(bI>VYFcoTrB*o"uO?0"Q#`?2a9W\+]I|(wVEOj_LA}Z{~W _~,dI^%{W>I{ܿ+*_ÔrYVײYڸ j+2T5|KPMu͝bHW##̭ SVnl6ֻqc,G;)ulղhsV=[ŅMɎ+|M^;04j]7 +Y{R/g%vJf'~=S6j4_K}N(A/EY>T Js?DUKYϲ)VW,e2Lyxu>1-cڊ1I:#$V*;\`=B \֦Z4nBK沐Ůf)'Ts]f6=Vrv٥)iGuGK2}ۮ`ñz$q]>(z/)P8?;N'y]glJTb%oWy#[O[٣sp6:V1X^A$~_eSǪ|aE]S];ۍڪ#'3#UQ֯;r۫~sC_xl+Ey^!NN{QX_*L(>NFt0zLVkx׺8ȝU9F]oNm;n]oLF| oV5dCk^j^ƿy׻XEZT#V&V_Z*yUGtH/qW5^!mjO?cb_t نۯ_#!"K쓞+}5}3~ۿd~}.ߴ>?ã ;Vf'To{׀=>o >e7>d=k]1</O7_Iac.AVfN ܐ~d|~sST;dBN+!,M3ǘ^_ۺ},%#N B3$ARFj5j#iW3Yk+vgozo_l5:\i2k78#ϯ-)ZM@n n{eX!WFō~h? .ʺ/y܋$ tͷ^Y;~ -flq&sdQ*s&H3tEQ<>hJ32# ~D{szELueSQj|('\7|>ղU;KM c>&^Cr؁iC7+Ðnfr/h7S.;,ntcSg꒮6dV)4}nd0q\eWIȾ3T<ٜv9,bH Ru6uV\[pjG⍿TiSãJ6OI2/Cn5N[WjԹ{1nX+-ծ5,*Ƿ^F?!u?#gݒ{;Fs%sD[|9cXc 5MrJ'K? :3Y7I/NU"bz$~smvGyڮ%y&VSbE>ΤJ󵈦&]&J`=,i'^/dG31'{=99*zS?>?D;f48Y'EG֡z[yUmښd*D卿|:Q1JD^ɣWG"+V6TTE_ROُx<i;>y f-MOZXxEgT2:jȒyDWu芤;A/v=y7 5>D~O"+NfW,t,(%:}^je^(;y~Oz|R'\O~ZMu[ڮbrŜI#Q>eImKTDUwFykWLTH> eEsSsq=#t"-WQWtj}%D_J=s7/qE0kN7J/FJ7|'+, +_NC=dvdEiqgwql%E6/SigDFXTZ~SlMc*ٹoiQcs;'tr>dFZ{3.+<_Obnw_m#<)zGyzx|z7(Im2ö~!ª6Dž۹b|m2=mhf "UTό?8Tl+Yn\,x·E-򧛴'$E'O+w]?=(s+Kcދ2̞WMtI ;aDžqt=ܖpG-s=KFˮBtj"1z)-nk-O9R|_m{+2+|Ky$IU^_~Odr\ӷnWmб<<#U^"XQIw+%nO⪶4a;S$b{)k_Y}}K#ȉdq_ 477& ]"޲73`^EU^ꜭџlQ?1l4&ow_ G_h%7:/z{ϹOo$/cV=_7ǯb%$w?OCW{-?Jcݛ`~>'}TE<ŞO37'Nnk~~ƺ!+>q<}Oi;Ns8_i콗|_ %$_>U{ҊJp_롫wɕar#yɶPrNi>~{G5^}㗹mc޽QX܈"W) ^s|%oT#]F[\^_LR ̬O]~Skߚv֨a՞ǿ"~U)P}ܟMs l*r˟>S'^@'<|)o!_Y:]3+:ub:{+}b{+0wYZO hU4U+_$L6 m[{ع8W->H{>;/)j]BbwafEJfЊô鎫jǓy<[wjщf; W1:Ȋ7}XePJs-cdקA#ӫVe/L=E~37.^?_K:;X{M,,dƁZY*fR2O#U']|OFVLΓدëU)Gܿdz=;!k^7F>nlM=wDOy =Uw!O|_=infr6VWI-L=UQUWT Oaw܏vO$s/2glqZlb|L V5͡Nj:sqܮ.|'lM=s*]{lc$n+\F"+UbycB n=O*/ (Mp;TeL}K7H#R l"+!6nX;79cHذGj9mbu~O-oipD_Cl~Z>țY3Uױd#NF1QNHwp$;,{URm`7w#% Lwx3+>iIkU>'(]2,V57J|ݵ#ˎ{\\wٗIʴp#zz'{ܾPlvs3rėw )9OkODزUnkeȍJZGJة~yNZ(&#rO+"tUawG5=ʧJ2>C spzK8]:,կP&kl$_/NT-j>{9˗9%|R 5 NY Qn\A|>D+iTc趬ذ#_r+&!z-oIvʋeȺT/ޅ}Uxװ~~}l*69bnsL7_>ʾzCEF[]tn8rʾGA ܹv*ޫV~{|>//ލDD{,}uT+}Tt"H7i#Z]X]'__5Rklv[G7Z8,OOp b+C8X|lA#Gz}ߢj'zcV5j|kQ|r@Jg'Q߸Q7Yξ?'ݏ@(oڿMl$8'_S' _o6t;~~b͇ dᏖ=q?)"␜OHDOkCoj?qoף*ۃ롿w ? 3 q%bl;?oۇ&h ?S1NJ&,gzeG/#g4_B0?ïG.$޿/e/u 7kv=Dn?/q(_O;>(4oua)1 s/\ԷC/=bWB@-~6RY$Tnߢ| xR3<&?ouqףL>ۃ77론ao=W:f^_7uB:z+Yr'_g 7\OKDֱ=e5V,v.$8w=i9yCN2gٝ1_ceu+fecB 6$nSfjq֧9F﬈SO5Q_WV]3Q:zglbLv5;|V">t\zҞs9infvV:2ex傴jc ]nM9#Im-n ҶkX+S5-,GѡEI*s}KIw ˻,lglk܍[]ݵG$G{.J]vOknijǢTo_SA"-^Vr̋:a/dQ59~ӏߐgk|WnfXpokEtXw\ߑ|[/R(tӑvjF^b7*^\z">I߁dls޿x֢_]-u܈>R~Wu[b oi_ Orc3}Yܯp;k+БZaUܷ,nQ== Q|jtW^?w_ܴG=Z#܇2lme_B+5Uz{^Qދ&#~K'"tWEN8q~v{~_#M%ܟts=fk8pnbuFzi(ĪlrTƗ߅-U=r/dlRSJ5KlrU >WGtg_"DL趭Oa;cFe^qF&B'e$"/t/AIa<G;̘[7)nˎ{u6d/萶6mx_?#ܩdf[q-p;ڷ!U-+F@؝ٵkZz[]ʝ>[?YNt#X+׫CZkߒ("d1'#kZ1uKJt ,މk:VYzK좇/ V`c:4_+"!pMsVt\XMG]jXb1L\.G,~2ZF'j'Ȉzc#o65Oj5j"L{"%wqũor;Mu?)2~"M8ƳMZ\{!m:6rCe9G`W%yϺSN6&Pɓ ; 7ߠ cy~n@pOPď;GcO\ JQ׈Jp|촻Ӫ}+["$Tе<~O6;uK^Zۦ͹]rM-9#IzF2gͭwYV7V$FjvIasl}7"RLVxR&W{'RH+6hqqS?-r)=L̐H m򦩨{J'otsM7RDUN,+~o=f֪wےv-ܻfks^BFym&G3a3 6qά|a:5~E)j}bY c{q9-=R|**EX^0% Jܗ7q x?%չ%A]d{=:'|XXgf 2wy,Rq?~8 ۃtM\l:9Yn ]嚫Ur;NN?ܠ_:TS;E_|Pss\*rUꪪ*7Vڿjl]v\4m[fGMb͛9Oby{ު9UUUT.Xݹjسfįŋy[13LMAfX[#|9^Y,kqՍ6̉oV%]v_x]]o] 㤕anH׫C6E+ r2_lF;+U<^BVYS3>gcEv񚰌=jr֣Q>v>Ghڲj't{8x=qoc6;Vn#yy%󤘼w'g@0Y.Efk5^Kvs?/ܯ?KNfōO0P## W{"Z`Fᗪ$QSIj(|V8ZIX2Oz9ʞ*#aǥ&y~; v@Tlg{9=wV8n-ɏՕD/U[Íԟsy+y%(rOoX0U{ҊJp_롫wɕar#yɶPrU=loT%BzTGEFʈ_wqF Abj͕bi#ĔlnTF=UZ|(3B'Xlɥ$b60%$_;"F9Q?&&d޶~TA)Om{N 7ڳO*ɮ~uaOYsڨ2C^)',pA $LQϒIc֧UUTDCٶ}kJs{v-OYl{>͖u.6sV\n+Q\""s=[ 6l']pT-esyF# х.䲹LS,HcUTD|c\cQ\9QkSU^S4鬸6&_~f1/NU~G*uDCN/bOL,'wEc.'[xJ~KUFer^ゎX U$n+5ŝbqܛBdyle8 :3JXmLzr3!{1,tPʏH#-E [Ri-}W貪}U߽B2ٜzr7$YȯVG<#&1֧̆}wC7wN湃zJ5!oYҠd ._Ro2PLXxzI챸 -g再kӃ̩ME 6\f4ʿz'OO Jfv;Y^@D^%ޭ] #޿9S=vm{SS]ۚw kxSbc[VN|~}UN=Q{v'=YV^jf-Z6&? NY&dm[yUk̨کJR>y>tbx5?~{ף߮THR+{}[9؜k fteF:M܆u/kUC) \t1޷ۧdrz։BYYn|cM+f \ `,9+P'g`rU.n -=F5e {Fydd+J]㴸'2k@>oQ?:a5 ʐ2%Q:#O'O=\fWi=7;_/Esu5X9ľUnۛ˄;r~d&]nceWv m|jl<FuUgVgΑTOwUU=R vvOŖpoo}~rO?/D?Pו5I>npOO^mvś-zɱ~S3D!9 @H=)tև߾~߯G)+T?C%aS~=)Of/UvJ5|w:rQ?wL~/ާc?LMGeof*Xˌ _Gh`.9_ŕ \I__00%-ۏn;ρz>_2Pzw}Qhr?1UF4Rb_.oh_Y{?'u\7-JZ?$l\!I-.ݿDfyL~߾?G@|+߷ooC@#M#5z"u>$8c|HȢ|8TkN/78lŲf1zf󹼅LVWy\VM4dqsNW+c2J g#enWc1p 䆭:u`ϒY1Ur'SkZrZUsj'""?cO4oMq*b+_{|z;aQdO V?υ2M}61:pWv6Yȉ\-<2(eHnZ:Lȧ\W:'b%#?`nh͹/6i$rȑZ0+c92P+t5bTղtY>~ \g 3Y 9N%lLUW{* hQZ_'ww9.fi<,tpseMgG;K 2s?%ν?OGtc%ZzR%k`<V%skUlhUY}j嫲֦yz5:ѱ̈y%8@lc9rxU7'G+b *kRgGyC=p\I1]4uߚ󖤩ikgeWW'P7w7cÀk-%{0=l2E)}l.Y٫Jr{I[ZnʐՆI_±:Oߜ5>!Qo#Y䷐s|sakz/"'Mzl6bJXʾI/3Z̞MΉ J) //wÒe[s`̛U['XܱbSZE#|fb7Kjyd_jStj'Aa1t*5еEa|z~#\ ʻMOMNxu+խ]XG?&j7 -Z^e~yZ׵i5.oA|35jf3iU$?JNjSzwwv'~Rd?Eqf 7Cm@um`s'K8t'jlMM7ߓ&"w_`o@?51<̡a/2vğ)"┢3T)s aDO9iעUU;UzҷȞ<~^/PZF4Wc x+oji%=rHjHtv5#KXU!֣zUpVQkeX+䒯/nZz>&D֣!ֽsɻ˃,I_~6LڑϷ5 ~trשIo\sz"f>NND(3R58Özoߥq!w)(Yf=Gb[Aec[C{>jǾeڶFfyzYcdB̿M4l܋:Zt2:XȽz#O,4q~OPךv-ftf{:ү+QTz+k:*5|Sw.ݶviE{?l8GI-nk> v4mE~'uɛ8:O. 4'+x׹ۏ PJpԲb 2Y f}K|z*UtߋȟIS? މ*&L]H=s+sUsU\*U_Rs=s+*s/UW*>Oj;5&7E+G TESl].j$J /zzŃ޴锒'7C5*F;qi7.PwՏ%,3+?;aG;n)|2ܫ& +zG+ ~Ϳ{jwا1w^3]2?aY~kΞy|>EDt*sW};^HYv QrcVc|S{g"3 l춶f}N9Yo]1=VR]oCcY$L.~&_ݞzv?Oy+}|hk.:ΣJޭ|m}؊HG[I#ٓY,",hA'eOM1515kQDqql}N'V 8^2z}*Ѷ*ҫUUQ6j"""B.\n2Lv:xQB5)S8+U]^11ֵ:"t"4Dj"5"'DDO;lyu?s|Չ~놹 pƿ_G0s_m|Jݿ.bHj}s{\OoOϥ)ٗGCV; ?+~ѝ6[Q[)ӧJl3,&Es*O:u_c@"'TF͏7/Ѣw|jo;exzm E]d*;/ s~ڰwC^zQﶉ"ɮ~uaOYsڨ2Bn1{1gގJt!ӫ+®ojykz"ۻ{K[)0kl VxZiհSY֥WmI_E$g&Id1pkOBދ,O D(x佃wXha'EzK}]_WV^W6-97Ï:>Y#:2Tܫ9,݊u9QΡF*ɯWϹPN͕Eld&eu FԳ;<,FOj8VVW留|ܳwՕcr<>GJ]|D%drgN;ؐ.QѪ5&_dV]ӞE#]⩔_/5v٥ 0{󷍱٪*jZM5dيn>>K5r#~`g=ZlV%&XG[~$O2h歮jW9Ri|&>IfҺ%oI'Qzȿ*U(GЂH:&)3:,fwk39>Wwסλi{j|CxhtzL!bݶ[w}\Vջnb5tcs߶~ G|Qob%7涬mY DI.,X3ΌkZٛRj0 5<\=zUUS*`d _dY`; ;7aY$R4CO Wy\P)V+jda /oY̝_1<3?$ORiO Mh?G?rCp{yt7Y?!ҔabA`UWn?[_OW͇-pyBf<#DѿdV&bL Fb;?uY_@ė 3_RݸFq?3??c.? wp%#STl<3E& N}R럚ֈa՞ǿ"~US~*ڏb?Hx"OK5D O_ Fg?qi½p{t44?,-C_Ǣ*xgPL!mdsV&+U%ҵ:+;:Ug^r'B^~zfnaרەtn?%<)rV(Z>[f^GOY4qXJo[ B;{*E+lJVo H֤R\tѤ%>dlAΆC%SjO*xq+𱳪yꯂ'ΨQ~WskÉ#"*+dN]Q6/Z˫[ _9od,pGicWG}\Ujfڠo6EVccV,6KS`EܷNZnGۭkZRë壂X䧒(߳1e"Mkls,bQc|3W~'KBåyy]d."%̊5z9j"TYފ_DɟC =s}newv>8;S*BV+Mda^ѧW)$6}K/Cdn^[Y~amHSc7V%\[W|BOMRІZAX XylNG~+:" TEX o Qn? B5ӢȬEt$DmXzkU < ==`MGP_}|Ę$nzЬ oێJK{.=r% nPP<^Q:ݼqh'}ђ%3[~ysFes'<đčcfu:5q!d,T4^{`TA\;"YCĮ=|x7Wwix{'&C\P)`I+K@~od? _Hlv2h>l ds9Jrw*2o!'q&cS`~//m> s'h |I!} )J#5B N\{c7|X?o߇ZT]wpCe-otw~|nTFKI<< ~?Khuz\uww|ѲH[dEoG|\z}XU'OD/6\ |C^Y߰f{n_iȟEUb[by;J/ַ,m5{_9̩ BUR̸0'r6"F;1Xhbi`mR 4fm{N_.b'>*\ou{u璜cjЯ+ql"{fiyQXZA>x"Wf~KzUTcDοEDcSq\O*lW(ʛu9nYry"l[XIXчU4F \ ySceNBK_>GB]#QeZ4ₕH(؈Ԗ,nWOfW+=~'֧̉FkgsV_&2^!SyÛѕ4{S-ÜiqUCVbdSO,bvZâVSQc"g͇U_g)"DDDDDDD舞""|Ȇax#d0 PQlF8cQDDDK1 1(cc(Glj5Ƣ5cQ9$ s@ۗ~o`1${!\đ1B1!0D¹W߷ןJ*S/ۃڏ)w1ߖ&Vyȍ&BzİgsP*5[%?əѾ S4KwɨwwF,4ˬwkqIݟhBӉՕ"1D){¿[C-vHC&_ $4N'EQ&hH"x'H\ٝ'ѕ$H`;vjuZHע~o ov 콤pX4~b-E;ㅲr^Ѳ*J+>l2W6Xofݖ6sɚ^.eV2&sׯrU HHKSWxl3&XTsUEdeFmꨋr:rx*F^>n1ŏo럆|[g ܵy$~CtgEet\8@ɮ~uaOYsڨ2nMVI~j: cۗS*'Dן}%}/_f{0m)jx.AG=c ѱUϫHr H+:ugU_W$&_tF%t~(KҲJmCS}4g'AA!h9YbzeO<wRsy̮ő+-۶HF6uUd0F#5jNͷ>y+=Ztى.1&?WpU,FY3KF(jUFy;^_p/u/;o9}}l9r9)|t$10xw\ŶEeZ5#(3Jv^-JezOjx1<$"I`m}g/Iq8crxc~ /qqCII Z{nX{.]l3=Ul5گkaghDe(e(4oua)1 s/\ԷC/=bWB@-~6RY$Tnߢ| xR3<&?ouqףL>ۃ77론ao=W:f㐹n1mQ:*%AMJ ֏H)Ju&ArGf>+nU8 }Z ;ڇw8 ;_Ƽ;W%'hݹ [N<^M:2͚k9_E-}t_$7Jm&[*H:WObIK4kw^os{qM#j#䯯om$um;S^ֱm[ xK3Ie|vBwص"#cc?{x*u ^'LvjL;\dG1rj _~_O4/̫z}({gzG?7^.NnR9w8ܵ'Ӱ%*m;\L}+!npUkp^)fW4{XlVZʻ sgis~ݑzS?y1ccFj"5j"#ZNlc}N&<^/N;V? +SFfE^:lqEZkQ RSZ>h)QJӥNLJdpVZcQb"""!2:""x""'"!wK[{?ZT |H߿ǿ7Od+4 6ipoځ Ó_ q>NN8ؚoC&MD$22"$;~,~jc?y?B_?dᏉ?=r/S?D)DfS^!) Q-#Qo_7]s '^?Pn*t ~X6kޔ^te֒cݰgWF+_桲YߖXQzTNjg%_OǩwXIQL$jg[>*9[Y#<Dvq8ƫBtZ\t>$8cidQDI,98sTkƢ""^s9pdbw^3s!Sq5&f2Gѯ$,M#"&9r5S8s9᰸l}̮c1_b乐d$}Y(خrQTsֵ֫sj'UUUDD)3|j و\#WETt4WDs|=q?W~7Lfj޹r|v,yZCwV&b%fGcbk5^,#a{ssj퇲K׹0f7 2>+Z}sVͱQ!tU- ӫc^:kM^V©Ⱦ'N*z8NC9֒뒤P|.{ቨ{ѭj*Bwۏ3m|o&cg3`mg ϑe_姄8|Tydq5CyCSӸc,ȻZ,F#+]SJTZks^ni]c[jkSU| :hS٣.fB䲎jwkSk`tsDFaJ;Y",o$U|iȓ^%6կ7u>1Q"kb72_j@_Vߧ7ltw7-:SzKu*^PѠoxΑ#vnus +!-=Oq"$_wNtK[ߣ0qO\5Ϲn^5M9kU_sDDŽ{U럛 _{~߮Ǿ^}(N̿nj?t~XQ["7e [|ݷ].M0򵬚Fo"5"}CH5 krj*T [/.{."j z̼1ԍZV}iԗ]Uk ء ;L:{z#9uh+XȡC%Db*3ɕ7~=ȈYtPy^A^UON}|zP? LuX+]s2?i+=f V9dVq呲1=ʎk^|6kfK/ZkY瑾hy Y,md{#\اOəcӫOF6 wd햚70פo4uVh[~e-kޗql5Z޹Eՙmnm*dz6*utT5@ɤ*?A?VT>}NO#/Hҽ_ekb_3*ľf}^jಽof1Piz޷-mIļo~vsh}iYe7#VH18> /76k׳?0bwy;G2Ya[T8$lݮԕIc- =LjK5}K⑷=>DTO/E(vKr 2ۻnWMfI,UWDDDNkQ Kܝ?3$r$lvv.k?YlٕQ^X+VUV(88ۮ+}-kP; oYjuc)m'Na"luWD1i+Y\{޽\/οI"B[AN!3dWky#u>B焐Wb9uTgFyS&_і?Ss_9[϶l"Jw}~PV8Z'ο?&SjXź'6'e }0_:Y.Y>l<۪څ}˔7HX.|;+yo*;t\F)/;+K:v?_ij+j5| L6|!ۥ67>[ǓcPgBr?"{?0Sg}^R0Wno?s\?K=§4zRL0_, kjt徢n0(_ODŽ99(7,T܏!]gs+5zܿ{a`aK*[ݯ.'wTl|et?<ѿ*bh)ϸ]sR 7ڳO깊o__Q [ д$IIfC[P]~+H}}^-2Wnps\߮FG兿kE_/ CGFwUcS׭Uڰ^+ʝأCֳ=#Y\+uJdf/YdrVk&^ ѬcֵcQ Fμ.o{gv=sG+Eq!)CJ*E,}("Z(8ۮkۑ\ͻ/r.7k #c8㍱UV(ԩ^8ӫpAqF6QO<֦ytJsUDDDOO:$%MN)WuͬbV9.O3Rܪ`"tTY+WbEk2uO]1Y(;i۱>.JY:f}[9H05kfn>Ul}I\uhKm1lӏy38OI>ZZl1ȍTX\}+_:rT}:ߨtp0Ȣ(kYqG1DDDDDD6x]g >/^u^?`18\R>Bqm^1(bcXƣQ6l ds9Jrw*2o!'q&cS`~//m> s'h |I!} )J#5B N\Ya\ ȟ"+(Wj}dT7vv9ٖz8aGl-ȫWlG؍cd*5Q ]`O mEk cmj̉Dkd5Q:*փUi5~VԬR!\T1kZrZW9TFUUW۷V[7YJ*[r֫Rh56lLCx!bzZUUDCŊnիVlYbVA^xfysccjrZUUQUW'""|Q-rn -Įk31QU :'OUO2owm]cMC][$o%NfK]l$]D;xG_‰F6KZI%>`W Z}a'^=gq5HeN*^-O3b/|d_lKyϣI)1zK+UQm9>d_ȟ_!?Lk<LcsXƹ{c\ʈֵsz"'ֹk9r5j+9z5juUr +wx!l Ŗ7i?Po:g'G/>F"kmTwmr?w7e%fq# 'Gnjy zz]c$|77`)ؙq6䰼eM,؜r9,gZ¦6X϶XK[ uG/ؿ9[ߣ0qO\5Ϲn^5M9kU_sDDŽ{U럛 _{~߮Ǿ^}(N̿nj?t~XQ["7e P?.VZӢIb_kNª+:)UEEOӣ'hq}Aaq{]nHmG\;5Ȣ|/gfTb:G$Ls)#S~ݾ9aQd#lu;7>)f[1#:|lUkI9w"|>wܱi#.9VWɶ^9fǢuUO-_x#YO[-ܷ;UE>Noնn>i"cv]U,Fjܿ~gk;k#u 9x8<>6I$H޾gEr/sXtOϒs>^FjkZTSPcr|Hom2Tl7^ rbcj3XrL\vB%!G"gT_Kqfso(=ms@sZ7bȞW!_ᙽY<26F*ȪH nO&Ն6}?eϟw)j~pSyeciyuU?cDJ±<:ZlVOS^$q/ҞźڗqJJy>UkM١܋X䣌ͲږyKO9f+f>\n=[iZ!rʳKģ枦^5B'KW_3-MdЂ.YU>~1>W/̟_3+ylYvUi]1'Zikng9LY6|pFFÎ_uj6(1ѕт(bj1wNPWnnMțf|{/m|1\+IqԡJl*CQ$ի3\K6M+r֧5< J3vӱSR50ԭz{6(W=GQ6pall|ʻƭzF$|sװ&JB&+EU_#;жTߴ2sf>B+TWk6KapzLH#/܍EDY;kSKjZMO_`#U*BftEEvOnӺ/fU"![;τLڏz[]jί7!qr>q&WO=yN1IUDڏi_dݱq_nS+Xfn]Ӑrmq߼REUk D1iAR>؞=EO"Bʰ;k?,ś},} )~!PyI+s@520n@s,w~NoMC򙟒') d_ A'OO ?z9H_=p, J}01 *-V'ÿgkfs?bhȲ?+1Rw\dxRr?E#?swQ:,OKrRY/nvȸo|SK…;øGFKW[6>)uKD0jc?[)G1nT$B'e% "InAv'`#3ςc]z8^=}s~i!|l3&` [f?MYT{ƕDwK^,5ઈUs1~noSQ^+}w'#oWǐ[m\+rZ5m#$ϭ^wԒJذ{lRQ~}qa=, \V !rF9Y^sicekՍ~S#.T1GףQ|OuUJ2[&Vc+:rwG*38 b#XߙǪUGv'pp\o'rfi,I+Mv]MfauOTZ+ #JbwsF<Ѱ˱Q׮ʈqlt-Jmg]$n/\qVtsF>W>Gɋb[VWu_Z#X+SQ#ZAROͩ^'Wv׭=|w8ecέ؟i_py;c*PVl/!kr&PdYѩ̳f25\zNE7TQE=\;"YCĮ=|x7Wwix{'&C\P)`I+K@~od? _Hlv2h>l ds9Jrw*2o!'q&cS`~//m> s'h |I!} )J#5B N\cT)޽:N ]٬p'kQukCƸ6[|i 3ah6ˡkH:W+QF)-q`; 6%]D km#Ṱ/N:>^&wɼL `HV^E.B=O_0 sQj/ruy/[jجFomi:HٷWWEt3Qp=YlTagt2,^h~#%ѫrK'E :Tֻ+W3U?~BFsݏe)r/>/^Vގj,v2/r Ndkw87Rʫ} ﲽY* φ#zy8M ]_!XﱞѬ\MJ쯧[|=݈WM C;\ ނvMVƺ؍ݧk7qW^XT%+zץQSu_X|\xmk6\ -?8V'I܁_۷/~&|cI*/vC"bcB`?r=ocum?>Tf_S] Xc,(L M({tlu:wOU7kzMM9{FN2[̋ϤщIe׻-kz˜V5Oq^O/YRͻڰd] S*tISyӪ'H~}bKbn7+ȷZ wS^l:tT꨽c'/n|cn9Rl{=a,lHsLk{_x.NybG76N{ύO+Q|Q/4RO"s\sU"9jTꊊ ߫Z5ѻ^tT;5mճff\g<ꚷuojZ1m;fT0 s_fy[ӹSⱕ%y^U臑g7J8=sZdNu1|&S!nelUh֒idrYWk#Xƫ/DkZr̈P# ZM_W]dH꣓a^[\{:y[CMϮ7ޞnd3e=&߼׏ǰލ.n,mBw.TB,KMZseɽWA?P{Wp.KMmZǷ2+l8I`+Ssqds*J^.bNzU:O 5<`'sQ_CA]U:9#ɝQU29(run'8+boӯۚ+iEQ$|3]Uw.v,wk]iLtUkdt6qs%NU4Ic!%VR~}4zeVQπJg'Q߸Q7Yξ?'ݏ@(oڿMl$8'_S' _o6t;~~b͇ dᏖ=q?)"␜OHDOkCoj?qoף*ۃ롿w ? 3 q%bl;?oۇ&h ?S1NJ&,gzeG/#g4_B0?ïG.$޿/e/u 7kv=Dn?/q(_O;>(4oua)1 s/\ԷC/=bWB@-~6RY$Tnߢ| xR3<&?ouqףL>ۃ77론ao=W:f6>I㍮{#X5{FjuU_Cp܆g3(;ucq{!nHңJOYd{c6u/ߣw)SԳ#fthQ [v݇^Jskƫ~*Q\DDEUU^*PW(on @&UĽQ;מE梧^ѭQzhzl=peVb#n]{9؏婅BؓC3֛-+7#! 9$_uLv&g.uԖ)]$2s+ߑ:)?~SoD%b҇uՖubߝV ws?:2F'ߩ[4Ya-v3<=FQƹs[)D >+s}ߦNjKgk봭sjɰK[{?ZT |H߿ǿ7Od+4 6ipoځ Ó_ q>NN8ؚoC&MD$22"$;~,~jc?y?B_?dᏉ?=r/S?D)DfS^!) |oeqyt{6#|:N>No_j׿}lvϱzomcOh'^gt껄5O { b}{yJ ~={7/^W'c[ׯo_DDǡD}ߔ7viZW{51;dTTX_QdsR^~J;F9;1ݶk}⬹F.6WO;=O?^'>ròZ7ak˭6`[xܾ"| K4+JgaoeEbO*^>ʋ$^*'PT4M4i^eG+I|{\ʪ*{73[>˗lǖ f팖c7ܛ!r7$J&y^%sUUMi|W`e3ܕo7vrVed.|.^ng,9ϒG+I9sW9ʮs*UU_UU>$+׉utS2Qf.D,WcUQaؚ9USpÃ%^});{9;,Zw5Ӿ8ٞX:^.⣥PW!+$lDZjޞ\3e (';kܹ>DJBʣ_r@w{МZޒOzDV" 5:}^/]~C\5b|d}5rm?_$ro8&(F<$&{گ\xW*v=_EJvep{Q8/Վ;ߏ0(O@{kG!M]y/D_ᮯ5`ywN'3:GD[ծG'-毲Ң;ȑ DZ<&8tIgE{E]_` :8i\lW/z3rxx*{`b^@\cH5w'ȶa-~NCw'6M>Źۓm6j1ZޙԹbx5nh20ʍ;K\m'qv Mj5m=b5Oq?(Mת>u5?mR(.V9$/>_"].aȞ FƯzːE~GƉ33~_s?-KnFe'x(aek%zF^rfV|GI& nO&Ն6}?eϟw)jO3_U2eV/GEcbrobXz/:t=<8cC;ǷqI {,NN>nHi9sIY|fKNgq|^%n\)[ǹ>SnScHaxK~80فP| 6Ln*7eh/q{fcr?EmdUDj힝>9HFYXh\sQ&_}ʩOJ1Wtj]ۢ/HWnP?0rw0ܱ$MnCo,|t?JU2ztl8px>>+4oJ9.w|iS?<.6ڏ[#5o,*~COǥ) XƯO[' /…xG󓒉",LKޙqK9vG0?Q/Kfdq"gy:uOQ/ۏ\ @SϾJ#.G]o*xfL@?5- y=DnUźiP> GDk0%۷7> wg({ 5hi~X[DUΠHuERɐV;F[zxߤ_d3I?4gʸdv/̫XtYm[4GsG26jnԌעW[Ck=vӈoW&ac*풲.QƮE6<~j*B~MjSm(k'Eef?=O1FsW8Os:Mؑt让Cuі:H> O1c,\tR^!FqfW0V+^V=w\^ ǽl\jc>ZK,oq4|OŢF:ӛz-6E}On܋c&"?222"%/=/DX(<:)r"bx}W |KjX_Dd$tPMq&&767ʫw=G`ck%r"i] \_7wvn=.89|ؚ,Q޻U#QzDESٕ) S( Ӱk>$?Y7jӯo$6_?~6|2_ǜ9;Tbji7x|q0?6t~e |H>$LMx.o7~9kUTkZ9ʈֵ""{vЫf5Q^kw.[:jUf͉`,WTkZpر^y۞j-6lJ+ׯ,4lp mW9TkZ"*DU_DOUKViz9eG:">JP=ߙe*r5|?]RϨ'(#5jq|Af'M:.2w#M:/V<(g;fG,s 7Xw|{߹k{x׃yYF-^efG>|sRvb rH1ɮS!,Z*Y>od__|Y9kXl8LGEVrӯV,m<B{Fo|K%^S?2$Ws;.:͑_eE͗|Q*ۡ_ԭOb(=YK5cZ5ckZֵNkZj'DD hRӫcףBTFH^:uk8+UmdqcDDD6ԩVZh֯J*ԧN1׫Rx zիEx"b5j#ZDDDBz"""""""tDODO>dC +ǵZzx,$DA~jrToz԰٧vܜmlZ9;1wֽkժ_WzR*UfoZo6BsZ9r0ժDNQQ%V䨹D-H~_BIj}s{\OoOϥ)ٗGCV; ?+~ƱĿlޟ}sZ;\WSr7fEmdJ$jhJ͸7+J268JaOM_;cq|5;vܔf̮2WjTQ5m0F/nUf;,XTj9J{U |Woab,kn.`m%&רf"'XB}ܟMs l*r˟>S'^@'q,pE$=C oYGmWr5j*x԰ͫgcֳw-j8. J|[-â?BM+܌6+Q@%z2ӂ﬏d4^Zz7T\[R?2J?Gu,yzlzlɶ8Oee1ZqNK!$ev̆~aF[a_"-E P&9}|K,pE$= oYGmWr5j*y9Vf})G똜{=ي7S!d-CV>y%G5\;1{7~+ ]ej8^62ٕ[zB${5U|sƹTkZ9W#Q:Ȉ=meW;V\qW %NOj'WʪiEwdﷸ~sv2a7.1$zTY~׸[dHab-gM'=o꺫{9ޗv.Vkb ]qWkk_ " kבg7+dR7[rI"j}!rJ:<mzDE2NewDUDW/ʿ/ʦLN'=9hZΕc3Mk6}n5rm &92[=v$z˵װ;&3ㅐϫv4rQ@s[{=jD{^Y勇chC+*WG|K5^~U"Bʳ;Iwh̩9\l=:Ǖ|<=_1}vFUx`}r>36}{?:N?VɎKM6d{G#[Уz. ឝzy@ϽO Q&rS[qׯ7t?1fÿ2ulj?HNC'PRq?|' ~x]5lF kgXTJSU]Am?_6ܷO?]4_ '%FEY[32#3/!saeƣ__o2:~KvE;|tꞢ_폗̸/ާ?|G7\LUQ9K~j[Z!V{W1Mkj?tҡ }?),aKp* o>o<)|ŦP kH eA3Tj+ֵ\TDDDꪪ מݹV2سfĬz1BX3;oV9fvi*zUN ?!ztI]zsrL Q͓{.93S'+NFxW~!:V[30>=b%.vs$V%}NrXYc["=Ree/WiKٕ#GWgVPbmm+G;$9˃MDC p 7Cm@um`s'K8t'jlMM7ߓ&"w_`o@?51<̡a/2vğ)"┢3T)v*Z,BǧUN|k**uEqt3AX߭b5{ jKp{jCbm^g7EKce S(d\>XKJ`|sG!cFG=Q\'.po7|ѳX^O%G*=^~Ftz6]Qzj63[鉹hvgo0wޟfh9޿isFj17Hh&lFj)q{\_)k~!\3c96 !Yb^~(}$+O}NCdfs֧1m^ovq^oO~V&ތ^{7szr]gxoc*I'b6D"SX7RRmfOv&/%ac2=WO~oa<+~iy;2=ҜjsaGeoǘ\rm'-y{Gv"u5+SEZ͑:KK<3uz,Z9nn;B_pky4kx/#z/ʒ1iA?Mc!QԳ,sRiV43. W̹ȇa`Vm举>UO\y(>vp9slkz_ r5|[$s`TlG1ػHf_&ӃaKCn笎#5觎G#e?يVZ̫whѫKJڬ=$~ ~P|JtdlO3{XTkS"uUC0='S{X` 1ԩ$5&k|=o^TNw1ylV>xWJi^^>w ~igNUQc϶w)C`85xӐ*XfƩ ՛n*N[ Nu?H>YYY, W8k_ߟaq:c\y65f~H'!~()>?<.6ڏ[#5o,*~COǥ) XƯO[' /…xG󓒉",LKޙqK9vG0?Q/Kfdq"gy:uOQ/ۏ\ @SϾJ#.G]o*xfL@?5- y=DnUźiP> GDk0%۷7> wg({ 5hi~X[DUΠ7-dcnU"ej|t[3کߛK|Ffm{5jG#`&PmѲIj|QScU$YYbQU{b:m;;<V~ZbnF#&o~|-b-=*|k/̭t gX[_|Щ z"c"""isn'Qlt4q+j62e)kֵ|< <;qkuqƏFȤJgB(q#Zֵex#!cQ?7 s#;t~8>qTaʾ FϝLH3^@nUZtS9;./Ueku۝2+C[-DZZ"f*j=nM>4f9\wL7{LfJ䝞WC#V(28mzV*Մw9 ~Q涉vWj$kMl|7-I/Ju F'twTVacI+*O"H|V>N:DbF{SQQ[-EZVsS})UVP虠|-T_7Uz *<~W[r9/֣;o,`8e+.+JCjQd_'WW9uM޽QͲony:u>|= &;?XX+urɭOk;^6?1GO%e'{گ\xW*v=_EJvep{Q8/Վ;ߏ0(O@nS9Q]TuI +ܟT^|lCxW#l:6wM$9sNW5|T%o8ncN`:|ż$15<;ȭ&ŔUsWS Xb,+K{ڭ{=Uk] Ou=`v[rL}tёI;^SԼ7WsqvG%dc] ]Yflg^bO/#ȑ=TTon[?~kAv$RL-=c[d*'W=zz/zRcYaYz/79>Tuk#_7cհNn':/_MoRNa|6h]ݺFۿމGWfw0Nn"#`8ƻ5Z"UkTV/EEEEE4[j4oVJ+TN2VRi kM&bz#TTE@îUݽ˃ƫN)^/F߂/-znлI#WGQT#ٮ1SH鑾 TFXUDEsPFm`dlt9cr5cQ\9TFUW3i]kn)}:XRދa"/NNW5(i?E<盗%7V_6yL6j>E;;oβu>J+V5@%e0Wm)+<0i\իz>(:*5dĆUe3wdl[4[5Iys}Ѹ ?⑺+UϜkJtν9>(eS@IeLcJ62s1^ݡ:.T$k;f}_o;곹Ϛ卫V+z܆ +U% 5\&*m-̝J{?.gA+ND>0dޱ6+w_ W$*yebR/蟿Lfο]қNQ*#(\k8xhَD,_R67ܛ}Rq~GY#jW5>UKZ;Eǿο}xroo73(!]Yvز=/ἳ+1JI+>+NP)Y&H F;g; Tٰhd[ [zx+9?W)TĨ W8k_ߟaq:c\y65f~H'!~()>?<.6ڏ[#5o,*~COǥ) XƯO[' /…xG󓒉",LKޙqK9vG0?Q/Kfdq"gy:uOQ/ۏ\ @SϾJ#.G]o*xfL@?5- y=DnUźiP> GDk0%۷7> wg({ 5hi~X[DUΠ-U\1Yg_,Jt+ ػtu^E?w$[3zqnAZXfq${]ңI?5I#oi{YTi#deH^[ޔ`:a@ \9DV:ʽ+nګjV^VO^ya sr9j\EEn#hlb ᑒ42Js$F9ETT^T/_EEO9P/OM_㐙 Z|09?/`=Q՗ͳ_dd}4=#E,lbb&UOgo*N՗+r~z~fGQ5)|*6G&m_"x*їߕr3dkQKFD 7Cm@um`s'K8t'jlMM7ߓ&"w_`o@?51<̡a/2vğ)"┢3T)vF_u.5Fi:*|oz}Dꟽ3x!扽wO'oz ¯jK$Pr:iYѪ*FHӸ^Yu #wV#YF阎TNN*Ə{<jl3z&@UWU_h,Ai(گYdz*"'U>$8cidQDI,98sTkƢ""ڹesy*dr ȪnӧOI|Ɖ.w_=i,Gͽ7-4ZI!nF#aaj""! JNfy}fr3r#G,-v*$p~'OF>""!".MX}$sO< .u{U럛 _{~߮Ǿ^}(N̿nj?t~XQ["7e x٨|Lj|#Ej'U}n2Mu g 6%>iԱ>xs*׉\=Yy5l)Wܱmuk|T9M+rJz&1[yԒ떿N?I؉"Ykߧ}5c9Z95z9jkS?!{~Wn 2l>I_W5-֞5lحb6jEOJuʙ fz.R^GEbz`h&b9EEkUEEETTTTTQS>ճ-5.ikVo/Nї"DNcؽ>v=>{k=ҹNh=n҂µqcy'ĭU&>FkdFmӞAڧoVk69C5-]V**owO$Ȋ|{b.wF\ͧ.^~\^l>|*: :5+f||DN5Q|VvU-x꽼֍_&3H稧eZdHRڿ͌I7ՠ 8bTȋWj̪HKEl/sQa>|>zJYִ;q[_|O^?? @%?0mkZĔg Dm:*,qHSEOƿ0`91qwݗ4i`rDqG$SX͇׳Up[)f>Q9\[_ӪK4~Kٷ}:=Lƶ*FTFʿ|6|/GfW/kqcPֶ]:={5mZM&D},j dT +ʋ:nB/+RQzH??ʺ~'>a=j{6q`XaV:'i:[ .s/'llh""Y5rTܛ3eh4N55uX#xZ7 dgnkX{gf~ ~_g/T%>9kتױ>VOs~*:ĕ2ەз KV9bQQ$x/W-cTRѳʖ#TI ZVO^hQQG'CQQQz***/TE.w,lՒ1jt׵)6Z$t6[3G#V+$t23UZG5WSp3#S/=Q#%KGf#sZEOIG"9>G"*}T>HPo0f߳.1"EEީo<)|ŦP kH eA3 wquW3WB5舕#"'_z}# yO֓u%oqp!G68⏎p]gWk܌n_+QҵޭT{Cܕ' zr'}7l ,ߛi/̟݁?/}Ҝq54ʇ~LIe|d̋׃sqLgo㯯г\{ibVtj/N6|,yXaoU_=dC$o+ַWѶkU~;$ W]%Yp}WåO+Q~_gv)U>Oh9Cnm`6mRMK,c^u\u#<fTlK׵LS~_;g_Is}${q-kT3qaGRsZk3t֌ܿJv'~WrT uvw gԚ7Կ 9kXNZ.O?zvW=onlbxxSޥ^cbcDݫ##*j̸ oUoU@(!B.u]^)b|'+檧Trx9<һ<9r#o/kN}?:A[OCWWFY`mB׷Y z%Two+nIjN/TVw|͏vM+Dv_mX%T\#%I"mVTFHI{"&>Ie6ʍkUU_C簚 5|n똜{`fnL=9\W#nHPhWi(9QTyk~\ɵ\!rFTVPosUW%ҹ>eOmKCypңLMVLg <31'gܥyjuy>tuZ<#^>lڱطI[7"/Fc_+USžl-_"bLS-]d,F3)/+sȱc_婕ٱlEJo9hj,#_HWZֵFkZkQ:""'"!:J*֣FzTiW:u!ZkFk֭^+ c֢"""~[s¯_m^!a#j9"'_t=J=@7ido!I=)͹E51 -ѱ3MӾ^noxU=SXv=k;v{/칻k3g+qkY &Q^=ڳٽbXl&_%emf.M,k]bꈈr5sU{rsUʿ]UN#< L6|!ۥ67>[ǓcPgBr?"{?0Sg}^R0Wno?s\?K=§4zRL0_, kjt徢n0(_ODŽ99(7,T܏!]gs+5zܿ{a`aK*[ݯ.'wTl|et?<ѿ*bh)ϸ]sR 7ڳO깊o__Q [ д$IIfC[P]~+H}}^-2Wnps\߮FG兿kE_/ [Ð-mz?<*Z~OXS4wVQ奙t셏n7 FQF,QyZgވT7wh̶osYعsGkYŎ?+|}ODވ⳿'ciE55HZǢy9ܽ|'J{no^#V8Zy)׻4;`T-?jg,ubc)\}quI^X9{{ v[6)r0٧`ik#e UDu oT\ulZD?~VZ]Զs.[i{7ln̯Wx G3yOveF![z]o+'o;CgY$Fc)49<*jo bvx2mΏ|Ozߕ_2Y_4M"Y+G+~:B'?Y7jӯo$6_?~6|2_ǜ9;Tbji7x|q0?6t~e |H>$LMxG6qlX1f:,gH\rm',Eg 15p Û`7seeG[sMꟁꗢ:)|}p,SwwAO!1^{|c9gȵ޲kgcv-usrҹږ[ H1t;FZ4\W,5mΨkD:s^E*,K:f>*m6G|Oۢ-˸bnMfj(ھkѱ^F>ȿ*|?-G yoF }V9X-'.CwK`r5j1_`YMe"# V5 >lUTK8 ]$+S}GU:tþ _R4[f;91 t0QRy|Kpvl cKEZ2kdozGY|]ppO}6q:0gFڙ42A2M9-G4NYd,i M5VW j?`u߳g-(z-z:؊ZmLO2ٷcpnU1ZM/r^&ZI!w!6m,I=\6IhU hell#vFN}\ީ/E49w)kv?9|Xu,UĪ5~E5sJg91I^Y^SGHŎE{mڮFǬRTUfÓt}C$++rI2+s7_*׵#oNh :W  ّy֌^j8tn;6|#S*"l 娹[nfxĹG֤kt܋XtܶSʿ#Y: y\S4_PX`3cBF{)Zkǿ'# /yerƔq3ɑL@>(~򣫉n5 k)5NkD;UZĉ^/fI1"+eE !Ѱccw,"'VO- 5zV+jda /oY̝_1<3?$ORiO Mh?G?rCp{yt7Y?!ҔabA`UWn?[_OW͇-pyBf<#DѿdV&bL Fb;?uY_@ė 3_RݸFq?3??c.? wp%#STl<3E& N}R럚ֈa՞ǿ"~US~*ڏb?Hx"OK5D O_ Fg?qi½p{t44?,-C_Ǣ*xgPLۻWd~xX4dz=w9{a{ܮ{h\9UW9ʽUWT{{=s*sGiW9^U_$^G_J>)\K:_ǿ:td#2$W![)H{ѻَS>\~*Vӗƈ80T)/ _רMm3C̙ _8s:#^ffv*Ƒ1՞%뿫c5~0nu>rm?%MWf˻y5BSnd0cwҙR{4LwM_NRyplipoځ Ó_ q>NN8ؚoC&MD$22"$;~,~jc?y?B_?dᏉ?=r/S?D)DfS^!)Q*#(\k8xhَD,_R67ܛ},?$5~`1sJq$'~T7d?LQiJ"$Zbs9U^̩V˺тw)qH^tSĹa8ޖV '|+}zy? +Zg\_2Vצ-Gvɖe\^t,nnI*jvb3lwuֶ RtUk\j/=,<픡2FHz7oSqO<5͉ yzY11dG|cUU~ٵz&okn-a1X o]Y3Y;R} ^2"28WDJX)ګw'uM^yy I֟w{?yܟo[/]*1{EW7Tx2;V $K=W^S-aͦ8Z>+mW9GBO:y rgF7Ȓ+Wٻocǵ{\s\5^k(hϽF2nJ~Gj/W7jJ-SVvG=kU̒7cڨu-Pf)ݧbj)ۆJZ#Zy`VDs\HEETTTT^਩̨|S~L{{$dcت1Ts\'Ek)br<Wd.bs8l<#+-<3' 6s'rY$R1=w1*vOrG4QJvYr`VM|ojCZ檣*/̨4݁F͵Z\{kz"Gz^:5:_L.qvu4]Ȕ1]j<r "ڞfFQXfkQ4Ws;B~ZLctU,_#`.ȸj1aKsmo3Y*,R#Qi<1wS!BTK{DOϡ3z|Ȓ5z}b&+̫þ1־7{s"s\5^trxnofqr|x̶''RnO~/cm-[nՕtrFkQU(4eB'.ϤaQ_.:G/UDgEt*ê\Ok-}ܤø vO{!$+a3I+!29nkS_= %X8 Rc4fߺ%V܃%QxОQ>o£h=eyOP7+} {*;ai迊ϑ:[ܰwj)jx;ʎmvy+G#_r䈩^}zGTEJlj6Dnvh_'M4rܛ篣q KjSGˏ׷y*Pc-w9ʳ\;>TWx28ڪHaoֵ4?ܟ-wܷ9sm<vGn2oZKJ1%I$1ί_,taE&'vH 5\F;w,kkNNx**Frx7C GPp-vb9c|jT2.]gYnr~Xhw W[ZֵFkZkQ:""'"!J*֣FzTiW:u!ZkFk֭^+ c֢"""~s ly|lO+#^cF̭juUU^9۹U r=1P{3VO1~8=&7 [{urSQo;byÙqX}ކ7Ji,ƥ=1^>w4ڞg^UU|I il5<ʈQG"|XI J 6vrAϫҾSEu~_wuaodycytqW9u\Y6f694cXw19z3VV;W+}=cDk^?"?VFs^Hnri"* f8LmN,>?ΞG9uY5_=powQlW`d-{WŹcjzJ~dVy9dr޵=ȯT#cb"'C)GT W8k_ߟaq:c\y65f~H'!~()>?<.6ڏ[#5o,*~COǥ) XƯO[' /…xG󓒉",LKޙqK9vG0?Q/Kfdq"gy:uOQ/ۏ\ @SϾJ#.G]o*xfL@?5- y=DnUźiP> GDk0%۷7> wg({ 5hi~X[DUΠT6DTTTQ|26:̨hZIw3C35n̒)cz5ڨ"E57wݔR~wXk$r39G1r***uE$^G_ <)R=w_v9:UDDֽXl?}L> "ûs/%nRn|ږ%lu8'&ǵQSb7UV#^W¿,x>V? ,VFg4+ֶd3XM;N֑o=N_ ce~|"}w6D_iU5cᱷr RT+KjĞ MU򱪩E7sؒJUx}n}w)]oM}\$2X':F(Z~Nã'4jka:g5##&BtUFb}EьDOxt ,ߛi/̟݁?/}Ҝq54ʇ~LIe|d9bHވr***uC9$HG,OlK#G2HG1r"E5 v-cG#{tm|#OM^(Oiչ܇-𾥖V%Wj|X/UG*Ajjmxg*vۿ?WW9̎ ]!PZa5UQU"ԞXizKHVhҵ%*9~X46ȟ:r|^>U;ukbY7o6<ۆ7..ַJ71xp"C/HqœCm0Csr6їuntV&^LƋ%S1ثDU1;{i^Ⱦ(˜?E(D`zKD¹W߷ןJ*S/ۃڏ)w1ߖ&Vyȍ&BzxO;znZdޞ'|KǻAtEޓ=&Ε֣qFkSE膱YSQ5WYݶӗO',j r"6jdzD 3<:2I=?=}fU|Ke fɕ*._w#823HkSF=Tσ(g;3ZO_XtW,_fG5VuFG;-kq)yM-0r҇r~C۹dkYJ!TkK#c8c~ *ѓ1:W"}eR eDy9.?ae!I܍XGQO ceO:Mv}ɝwC(`ee Oe_͵5\θ}R uc+07"W(Grr:nfl]Y!w\}ֵ͆EwFJξ UXtzesot7o\Zlޱm.Xt]im%U"e5N-˺WZ~]ж[xƹ EU>=RԻLkp=7Vd]NI+؉cEE_r5VP b]3uZn#.xUXSNwxO>\sr1IMIwqz>ZV3RY[#jS;fg]kYuO/d?'w_H# R 8'_S' _o6t;~~b͇ dᏖ=q?)"␜OHDOkCoj?qoף*ۃ롿w ? 3 q%bl;?oۇ&h ?S1NJ&,gzeG/#g4_B0?ïG.$޿/e/u 7kv=Dn?/q(_O;>(4oua)1 s/\ԷC/=bWB@-~6RY$Tnߢ| xR3<&?ouqףL>ۃ77론ao=W:f:Wz"^]Y^,~DOl[Q}k4{}5 x5,H7wrMW]]v:&U[TWVo^69"vSkް^Cx"ؚEVƭEs$ly|WezʟSy($ɈGVѶXc?-9Q` ""Z=E+_|`]ݦrNHqX#\_ƫzh*s#^ʨ>)<Uw5. /$; {N>ֳZb9@A[A Tc.z D]VѹQ>q'ٯ#eb(V/VK I"r*}e7ynjzfhz~6SaKkc`87QbE I=+_iةq$^WG"tTDEQ?o?]>o6dvC١wMl6Z{5dL?v+!>^?3hs`υGIoc[D;(qgbwΒV9O ;qځGMl^cQ̱ΞjE#扉yV9wk|%]BMHBQU̒jv$V-k*гάWڹ~caiߥ|sNsJ~6XH[q7 qYx`kdgK |.Ø*j'e_k9I\y"lc1{vbܞ I_Gc}(`Eʍ+/r,gveG_ w7ZJ=H=:5>dWQU)78_ySx7k5恻GVԸP3/m[mS ٲ<ӷuqg| =Q5=%1sneUTK{ϕtuzE 94^>;q7"~ G#b|{[a_ٳ7y'^dV&2 Т5kX޾*zX;{ww\&M~ZHaj:&ab\m?hHk$IW>H9+nV[#KJaE?[԰qʫ$X=[VutW>g#_5׬??Ƨ#o,j"')K?@D¹W߷ןJ*S/ۃڏ)w1ߖ&Vyȍ&BzN _DC$kD|ʞ-lr2t^"|m]%639l\a)|JOڕFgDI2г椸|T}6ovX||f8{I/\Nf+ØiV;'Gb^:lLǹ$w-sʿG^A/5o=U:ŖkOb*DZnn.?tgOU\R-9&#|HD,&uG5͊㕮k_q[Wiq:k~c7l^cg׫vaյ6VtjvUQQQ;t-5ꟿ3䑋T4.R"KRh-֑<;!׸N+ܒlF^UM2ͫP뜍(~^얥ZxDkj\G5UEjEEOTSRݪ^f+CnʓIZKUlֱ 4 =k.5ȷ/ZR>Duxt{>eC{'hGԻl/5y S++=kƕr1ZhXVZzFR2rB\tچ Zɛ [fV/6|`OcNzWo7g{lq $cVȲJÊl ɵs# ~lD\JRk9*T h+YT{05j75Y.QZkcR{rq|_VWYnw#ӣzn8ܜhW7|-l!Xsv>ft|L/Dq+u!x;wfkS Jw}+xr6g_9"r|ѬkzmL=W1]va\!{Ed]{pc=d8rZֶ,C5e{Y:~{z.Dͳo\x61SY[g=pbkQ#ƻY9eOp>-nUFedEH`%b'*."G7D^|Uqy(v=9{VۼrmdL*ԫ˛*unK8jREGV7^;Rsvgpmrٱ%~ sv"%~GtG|e9Ef6lQj?V_9>^LH=s+sUsU\*U_S9s9ss\9sWI\[qׯ7t?1fÿ2ulj?HNC'PRq?|' ~x]5lF kgXTJSU]Am?_6ܷO?]4_ '%FEY[32#3/!saeƣ__o2:~KvE;|tꞢ_폗̸/ާ?|G7\LUQ9K~j[Z!V{W1Mkj?tҡ }?),aKp* o>o<)|ŦP kH eA3  Kr3yUgS[EoRr_KxփvD5<5;tKA23HUS](m W%vźGxvWIAN^+UiO3{\*,Xr5Vś6%|,XiW:IG+*UU^UUUUUUUꪾ**S'?Y7jӯo$6_?~6|2_ǜ9;Tbji7x|q0?6t~e |H>$LMxG6qlX1f:,gH\rm'w vOI)yT:B19:ՕOZBV1$wZ3^"ƫі r,vjȽ;09USTD*߱>y?NON#ͶqW3k5W:jF2 kja'[=k_VNjk|mg9]L^ӯ6*L<6 ¹clpۻYz}DF-{^n9qč},+*H~bOŻȌͫ43nXFĮm(R/ȟ9<uRVi!=WO~oa<+~iy;2=ҜjsaGeoǘ\rm' oXmK9k,R|Q:UmH^OibW/[˳ݏlt1-׋r-FCM=W8-ܶSfv#G=?쓸F+6Ӡ_Od^&0bW1i7#SV*ٕkyz~U//ڈYKv**T_EO>eCIDK)X"7>9#z*9MVG$2I)b{)Ir"9cQQS)$OÌUm[o ZǣI"{HU;^#fb'+~ QVsl|{/lWrCxFt;)7|FGeVe+ޫy3^7LӬn nQ\g#{^Ibyn_=FS;JemVL|%UY!+]:)WD3K2#PAݱkJ$ Gcҝȝ|:e*HQF-U-ϫGo6érO+Aom⭶,dشJŜ4pކ6KޯRp({arھNlV^"#<ʌRUkRjtTEEkg{.t+nM-&b(R}<$*Wt绿XKRUױZ <2+;3I*σb^g{WTb$ͬuqsߥ&rw䳸vʛ[݆~mm'+hUo<\LrZz5Z5N#) X6cYgW,yoGC@jIR_OO?wğcz{v%{>e+{K*GtfC3|yL'2^[/N/}x]ev R5={WUs**Uꪾ*&仆I/#{5l[No wg7Ŭ^"I^k䱽pNF#^zO^mݨ%l;Xf)!ު֎"F֊J/ձ2&28㍭dq1DkXƵkZ3f p\},N [գc1ㆥ } (a(؍j#QV!ck7ڧc;:#d7WWJ˲tᮯr|?7_ݾ6qzȩee F,6 o'[r; rkѧ槸hOlV፬KC}qȍYl(6菉Zb,ygqH]'{FuI]›LKp̰]3e*ǧ$31 Uk:U Weø0gv5>S}ů_se}lcUsӈ|~NĵJđl9;cйۇsyfKBh%Rjv lӿU^ԞgT5+Z$V<t3}nڲ.˟g+dr7$mJ$G+UU%t>WI+sʾ* møe#Nj} D.|99ڋH_V'&O3U_yrv? SNlZWOCr9MGGa7vڰ̖2|}i`Xk=敉b:Ioۿ^jCw1cX,7i,^sTbݯ:ʖ#_p #=Y9>H#rvTӏUdj;mTj| 8cX` W8k_ߟaq:c\y65f~H'!~(t"aԟ3s@xǢ5̩$|4JdkXo gӃ%͘wU7z|]&rpCO#-\|7"$ݣ\ỷC{1 `-kQ+~9l1 ,8KJe=J-j{{¢*F|+z'NIpR@ A'OO ?z9H_=p, J}01 *-V'ÿgkfs?bhȲ?+1Rw\dxRr?E#?swQ:,OKrRY/nvȸo|SK…;øGFKW[6>)uKD0jc?[)G1nT$B'e% "InAv'`#3ςc]z8^=}s~i!|l3&`Kͮgߢ਩rzE[5|o=NCVJ܇vlo`+=W/ǫ|^OK=w'Bp~SG$[Sy=z3uoKⷍVlIL"_+){ רϕoTVb^5UT},|k7 xh[F5X)d$Xv\kbz9*%\>էcta^߹OF~%njEkz*|ЯM}o8فY_)Y+W}:*tJS9cSpzvSyt4Ln#/sh5==j+3w;ŻM%EDZ!/LR#zf=c8|ĒY:vhQ,~R?yEaYf)N,6b t"Xn_7zGKo9^ ؜K⻲Y+bQEl|z:Ǖhz#8OVw'NiAܳzWnQdWʈۓm.*6KSX!XS֫-w[Pr Gz2A {U|^QU(Bc^[N<Q:>_խhY V.ݱ-v|,NY|{USU%_ s' nʻKj7M%c/^d2Lk,LѬj#kZ۽o[&;/ ˙w}3{`6,s3.2l94һ5DkQ*I|I#{UrUUUαxSPvܤrCkpW&[DV*VFĭNN8ؚoC&MD$22"![[OdO+cE,gvtQ>esS;>ӻo;Sa5F9p\ɍPv'L~ܕ-{7+'"*<nh轖lϜ#Q̓Je6<ӵ%.2_Euoe:LE|KRU+W6IQz**.Vio@?51<̡a/2vğ)"┢3T)vF_u.5Fi l%&-돟-+$dpm_+JZU#O$J׷ nڳYz\`] OVɐc7fw'Y^04=x*>ilQFsDkQ>”[grجJSZ"*1c-4n6ڋՕK/Օ nާ=qqbb)}a6LEKvZN1>.-_%zdr-v7랳#>I+[2R>kcl$v֤RuJIpI׵n%^(Y_;_.E|FD0E\KgU18z͆)$w3,j*׶~sܻҲ[+S\08c|go[K{)&{cʓk7#sVr fa0zLwc_=̶Zb5%&Io!zumzTi\1TZkZIer5O\Ƨ"'has^dmu"c"ىjxXIUV^Ǥns?6 [CiU ߞ>Inٌ2,X=goZ'R?,ፆ{-[ؚkm}8rݨi͍y ȶ㩵rfn<=?Tp[nF<:1K;V̳K/÷1x}JE Q5>x%qf=WO~oa<+~iy;2=ҜjsaGeoǘ\rm'k*ػvUjUر;84={/oU]_8%nՒ]LB  QG=j›q!lm;HӰ׶ h/C`]bC!rÛ0~Fʈ1Y^㍪ֵ>w<%x+eb bz6xU{Vt{:wԏ]on4{Vægqj_`-S?Y6Ryk_-K(݂UkݽuzgXQٌ=٠em^i/a1l9):5C"W1Z (=⤞v#"sWGo-xӏ:-/YeǹV{R0Z##W"=o+n?NQtJ3+;rˌda"=Dszr";b9l>G1G5SQNqSn1^Yc=慇7z7tO _ӲM S~_6_ZIH-cr7{r=Ysk嫇Vy18 ]UW*ʪUU|UUWUTׅbŋv'nyZ4,ٱ+btO<9K49\9Ur8@:\mhRJc/ЯU芌oO*yQKz5>swqtmb Ɨ·d{VcN;;5f[g6+&dl+ `1XJI11O#"4Usܾ.r;kÇ;F8πnY5mmrc#[dq˘ٶ-D[go>1/y6>3QOfI%KlBeKfHb|NDO½'ȥ՚T7b5yD_P \}q/#oWn?r=j#Gf36XͭW1ToQ| GΛqRٴMav:mW3Z/Y8T!FF_E$4$=>kV^ƗbU|vf%gT{;1W >f=\bI> \w_Kˌhن=\nNJY}ozk;s妻 |M1}?v}3bzh+knۆviajڑ++MVi5ċ"9>~5kz}zz}c{KhlY|he I}SN%[1˴*+W +֢֕Zil;+)$=qzI̭a>ߟz)s',jxI{dy=zYQQrw=ʃjz]e_ufv6vmvhlKyg/[cߛo1lNdi ܴ['vUsXR{O7Ė~Oi|i._թ:1n3ȑb^&AV؁ִ+M}s:ܤ>w#o@{1?~zId_X A'OO ?z9H_=p, J}01 *-V'ÿgkfs?bhȲ?+1Rw\dxRr?E#?swQ:,OKrRY/nvȸo|SK…;øGFKW[6>)uKD0jc?[)G1nT$B'e% "InAv'`#3ςc]z8^=}s~i!|l3&`/9O_]Hԉ8+I[>65UOWFY[{ޔqֽv_]7V)^qᅟgq5+$s[sN.JQ)ӪZc)+ vKwp?rn]lv:,|&lMh}) >Si-Mڝd|*"'j}u(`k$9r0epv#^x׫''8ݯKX6;r1llٰLpx:,Y#UuZXqEi0';3YcC?F\^핥*:)z֕ zy0H>qH1T}|W6/V# _K"/M{{I#ܯ{W={\U|ULl+ry o5f2,rlF̗257-c u 筗m#v266[,|yk%;W͹%H\ם{n\b/jj{WOصS/ξ ցMbbV|F,MkQHע"x"?2:.ѯq.pcpj6?_B+HD"""&{Wu-noE PϩIR\Z݌kTQOcqD28DD&ōbV,~DN*y|-ˉdqsu:u}Y9Y-O uo }p.r7g$~e8owl>DHNsnj, +p9\qYgYr^ɒmN<͎WSZTꊄ XBm_y%VoWUS;w>_azo`x:4ٷVh㞺mIf[j҉ߋ7Q6d1ҽ%cgV?o4q{&6>8#_(o4}E59Y;1U++'NG;JXW,Q~ѻ32h# Gr-WM:#&kzDw9r?|K ?J vپŁ޻\fѶA3eһ`r9{-2c&qWmÏwޭ/a߶L#mplQCC;p%{LzKo11Zxi-z*jӷ l#1}JNl:9eT_z}FZ8ݫ=,%%{>ß3U7^MaG$9Y۷mc jy 1^ܲ쓳]=6Uam,&HTE0,չeydڶ ,m}%ogl;'c?k7,K l,%HI^d|{sGHUzW̯WuԬ$ۄLt!=Z߲#DOybtj{)Fmn}xqޣ<_O^zu;=md3EW0Ll#\fˍ112a8])wիw[?蜐%c?Bo? 0}qlYҮQȋ-':|zk z`;_C3q[ E۸lcrY 5HvϮײA܍]#0\d R6Hdkbs:ZX+g`Nݹ?b GgΔw-2e/{E}ZYK!O#KRfJ3QzId~|De:w@ }f$w-UEڿ"TcEUQ!eS_^.=0p7&r5^UYS Gq$Ith|qFϖ7c7,7d+g[^a83{ݫ2^O\hwthn_[#$Y"ϩVۛȒD5Tt~ohxJ;ݹ ?Zd%J^%H>Tlu>U=<<|^/UoZX轪x5g'o=s|m2kcYm{13Et̮aVO#JHEs]F(ܶ$$=}gYёdbtQ2"F*4աOw'qrEwE/$sLJrHʰlբf %3knT%YP$R b|rF{'\"*/̧lK?ڵC9fgq60`r˵1G42b9 ]G12rѫ ڞw4UVi?O+zM>gc\sα^N;KKͬr vep؞\~0ysxU6u#b e2%)r9kP ~)=[zccS>{T)qF=rÜSFn;I(+a4eDzeV2/^F+49/>'7ye_&C&ϑ+εɪz~ X}m(NejKͷڶLO5w+ XxL2OA[9 ۿm{9=zl[%V- V*ׯV5k{Uk5sW9E訿)սFNnJ\;!V/W+ԭܫaAf$s$s***)׷Rhޭ^+rcV[יzkV***"EEEEQSE-v#z&6ҺJ/X|brƕYn~tx˔ݻ3܁f_FZU#&嵮ް+:"*:cCs.he8qKSX,ʾ,[s*'!:"W5\nFnu_A"~'WH0@gLgMaA[%BHn?,չXߑ̯ej|db}E/wO%,sø(Tҷɺ?UU.Kɚf>wⳕqEuYDh]{W꼯h%VVS]Uf{B6z,j'CcѬdD,DO꒱>dr''V#Dc3GM ЪX:3"ȩ̩kڻoj㱽_VZ{6z\Lg3juW:lFՕWgT|!JqrFVFK;ay1|s&b'Ynɛ^9#\w?Uz'G!NeWWWz_=&t5ZkrF5Eٵk<lVcHTgG-4^K (;MVYe5.:֯kިfA*Ŵa% ,3޻٫?=r6۶`Gކ7|t*{_!W[蠲:8\5#TYsK[ȊEZ黑 3c/rFm׹dz^$mUN a:Fՙ_*7%hP7 N+WӪǏzz=4WCkp$6zwJ$f7KȬb4N^ziu}#ޗ؉"/GU%=W6{?<1~;=bu\U'|>B.thk#zx#(c<'%*/ʩ:Oωj]䲐93Ü+au))xs1ߧ=gEټ]?oW\~tL|[gĜgE"}9|Q__:} /{+!tΤ ïbjZ.IFO/g H_ِo?;D;-ϏpcjWN'63 s&ml\vVg(=X26V**lܿRӸB޼;NTݛ Va|Tw9su"+iV/TIe_o'VڿzBGf3[YFjWH5c?ƵXģ'f.9Ñy{lCS/lw24̖&jX4t:tL~&*LbEUSu;ܥ}ەǶhd ݜ8ȓKq(ᵌB̞tV]③mO$|#Q37""INĕ:AqOɛumfS>?*+d*/VMauD_fy6'|}0A;_ p~v))'i16;XWD'}5cĽ$ס[;uSb~6.1✼rV\qE)K /ͰZr>iN޾m_g=Wq1 1(cc(Glj5Ƣ5cQ <Yo׵{0<}LNԆ+Pn/Fpׯ l1DLqX^6 Tx^:tn>pԣRE 11Dj"-kZj#ZFDF=C~-Y-\cWToFz*_Ꚍ>)lͻ.7?@gNYgrRYk IoΌdW7drv;)Y8|KR\w!ګl>Nײ+Ы#(kS/;:GmigK}\~Jbʄ8Ln3ѳ2I6 eƈlr7!jXru9UEKz g}$~lM<6nc'G_cW^w5$##zXߤO[ӗl2ySulcY6AV`+=ѲˣO~k.RnVI,SE`s[곣Ye|BVWET+\+-GE<G7O3hz9DsWQۙq|o|۷&j[]mE=7d9#`v,L{P1J56=6qOps z"Q&uF:> cgnNdX扏j&{0[֕DױzEOONiu]5`RIٕϒEk |1켟˛ޣ|sem{bmW^Cs/ڧ cU"k[DXKzt0Գ#扤4dl;fۙ]YlTk|Es܍NTEX#"HcU\DBy]6Ikz:+Ykaծf5FV'7Ȓ_]{g(nz^eg!٧{]:3J|ٝ]Qc+&U-?O"%=;.W0qյvzy.: [UZո_u3QqjF[%ElOR^^>UUrUWUU|UULXn5Vś6%|,XiG:IfG+*UU^'M5bYg?<.6ڏ[#5o,*~COǥ) XƯO[' /…xG󓒉",LKޙqK9vG0?Q/Kfdq"gy:uOQ/ۏ\ @SϾJ#.G]o*xfL@?5- y=DnUźiP> GDk0%۷7> wg({ 5hi~X[DUΠS*/|F{\DZG1r+\5Ȩ*k^1k\"9kTV/ܙRr4#Y|irB_Ixb/iA\GInDKݽM$U9<9ߥ[#HNNTvW^,v?)q+n$^'WXRGs]*=ΕЎWuIrrSEU|ȭ,[ 68)er}ܪ:F *X? /Qo O g>Z7:Whc6od`奮g14W'zwٝl^c|\SkWBiҪ1)ޥظW UW=\ )F+ ,- ƈ"5URHBv3=VOtNHX|Q$z'YNj;g<ǹ*޶kHGe2k8׏-cs&/7e*ҡܷlo}ەvAgD`F篞dr#ks49.S7|l_bsSuq0)s/Fέ9U|mi+'<:*%O*$KًRC9OW}X{]/GOknYͱGbo[ trѲVk WAc3Ė+2.#t?'WUov*=Xj/鹓 3O#2ocR_UovszQW;djxY*rN|Om6üW$x잺~ڮ=,lu[:[C(d.'P9wXToHWF7֯K9魯S[K'WgO1yl5F?[ʈ؝W#USy\QE{NjypQWj/cѷ/{̥vbxc*dfy8b_OVŘIZ5又#"<~գ]TgEխ('fGךx(Ϸak*40=<طw ]Ʊz.d$[ֺu|uؐՅ>g{dǧ_ھSZ엶M1J/32{g>,Nմ-c%ѬXoh_sV;1+Js^ jq59Zo\+bt:ѭX;?'|UZnn^5c>Dw{i>Ddm_"[kb3y;y+>GXV8Y^`~6Xs^k~'w[;}{m5lqnB::f֖wp}n;ӕfvҳ_67 5ڌj%O2ԫ[B6۽'<Ǣ EQNc~"!HsO^.9gCc2Jsz/_Qקґ::D^_ɗWmջWh=Pm>gHxVV嵘[csѻcq?*v)eFds록3=GŲ6>2Q;9V?֫C.]k?E+`cA5xa(6"5cQ!VյY/_zkz)aus_҇kx^>pWl1D3jz.Ыa0غRbXQAOӁC LdqFkQ 66kX55kZD興)Q9`M~8saFzV 7Nޭ'uV;+5$ףG5~T6vGo}~]d\M%{eNmR;̄ԓz] w;z/^=dif0QScaRt|~'G9s^U{s9Wd2 B[-zO)g!d,w!]n^rnIe|rʪ"n\۳!~o^<]jWfݻ3XbgH+UUURUUUUUUUUUUꪫ⪪*:Lwfe'eFC ڲ]|1Q>n˽#;S87E=q/f'2/u݋KK\?~W3#&?(n^FlTrsI=|O4'2O{ƣr5F܈|7_c[FdAN7r>?,e 3]'bYMiEf u!k߭Z]1OkݢUJ#UZν ؝QzD:u_z|OvOM3ǘ^_ۺ},%#N B3$ARFj5:?ƿcǎ?tNH!sc}ɷܟQVq,JǢ"uv=,gO-r5<ߨXG?ɘ#c;uxfh$+rz=,ZqӨYWՍsmym{ޱڦ+-p~0_&C+oY]fݨHU&6էXjȎlHiNkl%F7=ez|V"HU;i5xZ2ӞJ5MI"s]wO>Rg6o[##y8mi[E(gV{H:і+9BV=Giʜ;~7=q=Lvעym[?V)|Y<5vNX9aFFr-Wer2'.g _t~V4s!>پ&;&w/a8Sɓc:/'lO2NXW+]=!#m'c]O:rlc9Jmrؙ>uڿJYz}M#ǽ+y**y{\CđK[_=2Ur⭃jrUQ^r#^Lj&O:u# #{Ot+KW+ie83lwNy0՝ĈܱRIfu|i#:a[85b1t-M|SKVNto_.[o40cqCf\wYf4@դHV*ˤY$lҪ$rھtEzpI"E_:FeU=nO&_Mf\>/):|Q~^9mY_B'SCn߹&ʕr;zk|6Zג,[##QE.Y="\9|Q}խTjƒ%{"`IU_VՍo{ȩO27dzЍ*ױe2dR9u$ۏIZg{̝%ڹZW(T*ft_0NU*IOY28RM`G)ZEc= -DWTEBzzw;['`7\_n\{l߭p|7;2$,%d.ݤ9ԝ<Փ ^rQdy+uk<2עVBSsUs9ʪ9W[j7Yv[rYnՙ56lL=zzUUUR,Xb{vիSKb͛{,NK4+$M#s\*RUUUUUUUꪾ**S'/_ԖOA^{\*Y9ʍkQUU o\O/i| \\\^k[=]by 0|ڽ~RR)'Xc;g{_xgJr#nW``l-RYjҾx^62XȓU^74rsW=^ni_U~dj'"eCGvV+ zQDWҡO3aG'ӑQ*uDDFBA>!r&c=rV!rtVLbnWc%Ŝ>mʺy*dsG^}1^!IH>6ӗu/tmϐYSϊ1a5?_{cl?rod73ȫG6pXq1Gf#Q$эPF]MC!bBB۶T|(KUzgUTL^=;v>ɼ;/SFC >ī-+Iձ~kcy-zvvYVƙ+LX}}ÎI$M$uDg^S/Q:X]ΒC t+UZTTUEEN ⊊i^KԷmUZkXدb9")s\:jK^Rb dx&M 9Y,Rk7QTEENHN ਿ1p`>vhԶ ,~Wvw!U^9QܮތD4[߈ $OM^c=rߓփA"iI^*8~L(,^&tPgpV\+C7?AXm6~:>\_ i-grKrGS=?:8|ō"G4H֕ѳF _o>_LLHv^khob.LDVOe :,+X>U_]zZq/q^"1s^桝NBHK֝r5mcs%壋X6ily ;$kM;ͻ6w[%p-<&r"8KafɕISc$ b*?5:ȩ:路ᗢ[rsy^ ]G]Z,TjڶUEȝ:1jfճٖ匯}b%O]B5fFT"LlG>r,^b<}l}YYuw37#ș"ײs ֯~Jfss7wѕ-n6?m3)Ny|ռf_g]U}>dsKȉ@eKl85ڜig0g9(O3*MF*ᮎ8Ymr߿A_wzf[vyˊ9 ľj7=B{-Lv> GT̽f3NܗQ>[o;OڝdZqnðMX;oufY1w^䡍ecIOs[qN:Mtլ>x"n 6T1ղػI**ONvE_gb7FoT^oWG")(4NCdy~>n;۸nEn;K,쑕\s{JV+^ƪKaK8s|̎Vɣl]R=q[.**͊+rgV #UTv`9|OO^j}tkg'K8ۓԑz+ROdk&b*s3ڿ;\;u;GCexJڸ97>|IcLl2I+8%EwDsȫ.ۻqUEF9Y}Ñ\.BjԳb{wؽި3J#r*ZJvg/â/z#}ev!w\^DOE4jz~T'krh=s<-vxcv󺥩h=9#{lYd*mc ԛmGa/ڱN*9dc\н6;2ƾSV̴Cjye/̽>Vkڪ:)q k`a1F,՗-yZ2QQM݉w=}pɩW%-軕%v;v݉"紽39"؛b}yNHw;{+M~zd9:UVզf>̾z'#l+7vPB6_+U|czx>7"~C*{+l2H{Ǣ{\5^ylN+?೸~k pjU8+#ZJy fOr9_ߩ3X"U)}{|A2 W٤w~H^b"5pTH0;+hu W[m}erP݂̫bB{Q#71E [u-Q5;j9؍ Hލ{]9 9_Hڸߑߣn,YUeT5kF3'V@HF&wI2Aj?4W5_'/ȪEvOGOUYW ݛ;(+rE[{U(Tm%mXޕl35Y]wm@+ LMӰVQ+?Cg 7Qf718m_bC%,ѧ^7I,ƫ%l𭖦ɟ'V{HIm7ƞ*5_~)J,ݙW,fŹklE6rw_Pkn6 <s(Z%VUͰߧ{a 6S{imf͒8pZߴ!jg><"&>j*A#q+!j4sN,+e>urt7뢢|Mx8FE$=mW$Tk5{ܽTlŗk+%rTpL&_3ڊ7Ҋ{F!cWjQ3dl6>[/Sc*O%_:q5cmJ6I$r5ZTkQ\*5j*W""xI|*==G̞Y$Ds"ɲTT|z*AS>ڄgx^:}\lSn.bu{5;4rG+[PjZK~˺y_62e_~֫=+ 6e,sZVIG.ɠVUc~,:ZL,\1QQSwgȟ?JD䱌6cZ1Fj#Zֵֵ"x"vcZ5cZkZֵNkZG?@CwfuhUG\%}Oedw'U_O19{=P`n_b[N^-gljYpY[X2' X+da  GS3rjfJnԴՏs݆cC2mQ:Z{C{q]ϋrv\,%s]]F'Cӣ~b*zuSO!r;@FV? kYa>TO[S9僪L_Jq|ݯkj?Gnېr9l&۝$Rrx+M^9;]s1nr9Kb,{Q֪Trx4E5z2$=~Z3C{+1 ]9U:{[6-^FfqO2|UE ?wwcݛv; _l[dc<)zٚvY!_j|[' ytI}Ñuxsx$\gx[#z9Շ,۽5R UrG7OOeI7m:OXwRU? 2nEwULa{/Oli۟.MZ٫\[Ȭ|-TMj VR^JZcS,L;أ;={XjM OV:$~~ҳXb'E!{;|ձ6& z1ӪCE tX,ɔ[migNA \}OEUDZ~w.>훷 :mӔy$ꯗܰM8{o۳.X0[{\H,E ϶ysdx'uvuOub1՘2.ɓs$`h-r9Z#d>8٧N{#Yyd^#Z߅cST}KiXMj_,óoTٹۙ-KaD2Ly~'Q8 K$tx(]vݝOb@lYݻ,[4W5{zh0̧QtfyljA})̩I~ףSO=+,A M<1+$1Q7ܵ bX 6o^n93-#;hsQQ6(s ,tEPI4mwD˖!tkQO=޿'ȝzRtEy}_oQԿ*?M+|18i /Ϸ_ӕ|?~Z~̈́gmlT{/ʿD_Ǐg_-s?LN?wZw6?=_//ߖr';a?EKr\֝M~9Wl_\N|Op}JGhٰXD"*~\^UD^3dvnWZ֯=&RV6?N^PK5 GFʪ/N`Fg0}b5f)LIjM3/UT^K]u5}:Qѥ01 *YԓMJXjI#<ʝzu6 ;~qT{.ѮϹfd:/6gVm5vIJ5W'_ ]=39_goGVn[+G #mY[޽:_ZCز>g5dNFo#Կ*g?l_\?LN?wZwEKr\֝M~9Wl_\N|Op}GRtEx6x?Cul'8{hc>ߩNU"<~2w<}{R2O/_}ߩNU"<~'F/TG1{WsUSHǓeqlΑ17hdtS6;t)Zr#ZT_#dzQQlw1RGDFi%F\ G#UU?zݦ"TYEEO< 7)ye~G  ͷ Y$R_j**tR48d)wmF)b{)6L3$F9Zc9:~/ϷԿ*qߩNU"<~-.Vhkg75ӗM~z7򢫼Ӣ6|.y. f5yog*co;B[sBbW*s>\}R=_/͒ߦ|?~Z/ul'8^/Ϸ_ӕ|?~Z~̈́gmlT{/ʿD_Ǐg_-s?LN?wZw6?=_//ߖr';a?EKr\֝M~9Wl_\N|Op}GRtEx6x?Cul'8{hc>,s7_c4RzyׯNU^zj6vYZ; )6[~12Gu JZFOOk`s͝<#4clmwJX;2Du>Ck\t|z){Ǯ})yI]\[4b~j*j"3#GƝVXS_{ҚRmo5wӡ }Bֱc1FDkZ֧FNֵ"|4ic)SikѡBxRJLV:ւ68ֱj"""ԩVZh֯J*ԧN1׫Rx zիEx"b5j#ZDDDB`"""""""tDODO>dC ;ͺ /׍_{](V2Q'-~z|1`;)˝e<偎/KlЯ\ Lj9VJ3=WEGXwn;V#vU\dzӆ-b#j#ker'~5_׏cczEVvV%N(k%0bkV)o3"דSU]X^B{So>w}n o6y4ǁkczw];%GN^UIu=v˺;g2F9-JNz;F9j9ʨUv^FOiRĐ=zy/D^z'TRo㻃k1#c?*';_^NS&нG\]\?2lS%n5ȏKevq=V4Tx_2$$b'VuEwxI*'F">&m#[kSg\8yѾuES~=U;2v=K <cSN=nq{kx~5k_܍roc,^u-w.ᄫu/t* [YG ѵq+. ;;Uoeo䗭[td-_"gFuDתr-Qa J']]S$"&us޿EEUBz_3w}|qۗoVK~~Rتko{#`]soe2VUq lqRmpWr\pj׷C l&Ilt繖\ F-/NJ2M+*kMrxWb,Fk#XU_B aN%d\ٰE#Jl^*S7z7zGpߤlt8UL^Λxjm!kZV ?4,tΉ$fb\eY^ SArj&F۶<ߧXq菖ԬK6UXlD8:>y::#P󛖡K&խڍV9be|G~w_j*"Wf2Es`ᥝj&Hr.w")籿{[9T_ӕߩNU"<~Py$sXo{19sDkZU|\o;汌9TkZ+/DkZU~C/,gH\ߩNU"ߩNU"<~ߩNU"<~\&qۤEulPUўGyOٽ:WҎϧO{^L=m{T%n-Z-]!DdӤ_` Ԭ5zzyOGuyDo}^n/ؽ;mv޸Gmq+:G&qFuYfĮ:zT.cYaW_1,C`D2L᪬.jNF^5H^NE_}>81wMTyk6'Xڹke[PhkԆ;L5l ۲>z\OZmu{;f0SM7MEֵ h=bV  |I">xȥn{h:KyK jd2ұy>\͙ñl&WYnԶh1sVG-lHٳC={k.Oq"H9r(G;ϊ5n?6r"29nXnyj{Ǫ,닻K^βfRekzCoEWڱ>o/_1,CL}w}n8ʭQ#ZYh1ьW9aFV vSzv5'prkSqWrcCCخ򖷃Oc?QHֶF3uֽkCNG+ct1"\NqST4F4FQǶ"٨"9U%kQ>dr!1k-xZνW+.*'NbO s"~'kˤ,lN?>K2+1y_&Y@ڑ9kTr5[~+wIq&ÑHﻎI$f?/dNXbryo' zVK$i$ig9sF1CڭY)D鮪/ʉfۥd~"69>T_D_>}`: TuY*Xq^kaUc{[n!΃g߮s㲏::V+L7u1W}i}nw[y8XscnB2twYѷe,5Y CM<5_/OFrMڵfmܱ=S52r=?~~5ooWOoob>O?ξ}y>5|{/#=t<n1>kY&n\[ %rve)DHX=oE|r֗>s}wkbpO_ZKCdlIM%f3( jX8"Kti}c2}?14#{~NQnUw,?{kcU,SNNM.eq^${ufl!jk-L4WFٝZIXj\l͊ ʹK#+Yҥ#+̊#]U)Wh򆿧o; UqG8؝K9_ә-3PّejylLd8Zj&**"TTEEE2(hEKO&h^")XbG#"*/T9!٭ks\:ImSŔO±Jԫɨܵv/ę Qgmo{\_m^f6jꘙjI#SߗI}Ң/GN}x9)zie5s9adsV\4mխl{ /A\$^hn쯙|s&mnre>yWbTlbz]_vlKjT8KGp)&t >g`gFו [W*5sֵUʫ(gRŌ'r%g;sϏ+Zը$nev-` Z*ԩUWA^1FGֵ>d6%h:z^kkah뚎b(uobp|l5Յ65UTi̜pv&LM_&*Mtk=U EAz짘s]vϧH%F5O\wnŲ躕x7FZ׷H-26=)ZBY1#\tsJusdkS´_蟁U_"xx(L5_7n; FKS}_UOmnÓ}j*B{Ojk{G:ŧVyձ;Go#2AR'H3HjGc_Q>+~BHoGnj$誋+ru UZmfu{_akzOy20]_,]x>2Q&ح5s*1hU.=3S>)c9l]IsƮ_q+<: 3VȖDjӯG ֧["CuyKno`XuJb^ԓW8m?n|+_>F[izsCOoxA931-Da`W$#S'8&ʿZa.{`R_qZ]7O_,Kn۴D?Gœ S$z[_WM? %vr&Dܮܿ]}&?\LbOp n_}{1`э~ySS_yS?] y ߓ,<)W7sO䬯畓m]?^~w f8r8`zP5򿄹#4XT|W$f֍~BTsܮȮ҂9g`ִUgaO9|d$R#  kx%E:C^>{SUjʈUQ;엹q.ʛCYɮ.7[u`^Fd9Bؖ(_Pv}r^;{ } WjJewÆjٹ4MUlQ$>8ۧF Yzx5GcX{x=!dV,ˆKNb,dW,n̔g8K<2.[- ?~td|~Op1"`>^1kǢ9kQsU"T_Cc؜yL^RvK ~GvֹF;,vF1"kdjVZzW݂+TӵRi$kYG2Hcت~*"*****uEETT_EB/ML٭S7&*U+V_5U{"7uUrlw0s>cއ~S!ݲKiI孬ob|ďlnZL~dbd"ECNO. r y2KS~/idl,c5y7aK2UmKrRhk=v*5U=>}t_ŗ_(n6bln6/\!^+1s5UQT<\.h|{gյ3L+6G+,K+᥌)C-,}(%fXI1xyQ>#r"Yx0Ʊ&2:I$IZbŻv$:I+r9:<姶;B\QCBOˉݻ\e/Oklq~}H݉gdqRIňUY.L"x5>_cuHڿ*_&i~g%u~e]yaWԿDK}*y?) 8 QL7q7+Okos9(Q+g(vF' ۫.A;|i\kڋOyخj*17' z=MovٕzⵟLGt9o_kXl D_eb*+UּN_ETM2k݃w}ͬtqډd7MbԒh[&wMکEk9$;!E7>om8p[yXw6 ȸ]TM 6 ZӵsU SEJ|}*gHc_3)Xè83,9 K$}.dK: ?r=uEDɟѯԎֵ\fK)N|TKMږb&yp9FLC;dYOw.l`Kp7lS:vܦ7oz%̔l.o &5R<DmfI[@:>I:6TD`b#$gZ߇h9zf%/ ˑXbWO(ٹq ־G}RckF*?3Ksck+$mjYW/O!OO TVȨ<b'n ګ4ֱ^/tsA<25E4R5Zr**u5 զ MrX,ojʝ<SQ~c8[q.\Ijk%Dm%VT*$ű5~w*"K55ܟ%\[=UQPt6lq7X ᱘ ؙ2ZInJGGFǽoQt~t|p1LO7q,6J">.Z_k/*1;I>GJXaU7_!\4TFէRAZ-Q5>"|*e8JN'0zηt3[Ms\Վ7B:G sEt9sL+V;:~ޫ`6+ eZ4)ު&'WI#^9slpFacc6ƧFNd!^j29k9+JZv<>$VwOSU(kԣO/.;J[ct[hNxǰ⎁=8p24=eUgԝ'kzyݪs7n{h6[R߉Erh{7EhVbVz~^3#FGOk7/%o҉WOvأj+Q:U'_GE,n 5QM#&qݱ蛶bGK/so1s[k,/3x]7fk7LEp6<ޣ`#ص̕FkmklPӒ'UO3|PFd|R5Y$Otoj{ZECA2|>F潎s#*sUkQZuEOSsױks\VjkTPVoɶa~fgG{ɐ^u试򯟣~D1x6o{ ne\3qe]|~ody[is\ywFwz!dxӵfFU̍Q誈ڋ4aTD*EUQNE^] w@2DqO{ڤC[xz{Hҗ]33]|W5Ȩz@κ3Qfa &=mJ~0pwZY5C_XӜ*k{;db}%YY:|U^xU=qz/ʔ+_o"SǛ!Ycf GZcbrDr"yc|ZП Q&ryÎ=܌ED$oщv޾mޙW,|..sn-{rctw·٫a%loItm[siTcWl7Ⱦ{6_?O {,8.Y~-cQ|й{jqE̎Cq[ qܒ@ݧwZc(ڮlb2: $w%F峈$u]>_]*VM?gg>\֧ܧwPWŎq05qE皷 hfSҽfKo?:#Ֆjם2uSbZj'bI")=TT ~KN?N?8t85i{V6__5wbL|3מ/GZ oZ.vǼa#q^_`K du{; tsC4nkG"*|KsFcdFǢ+\NQ%u.K݉ _69^:9D]P-zYn>h3O2 Y-ne,5<7CutHS,; V6?W?GFگEvK!{=Vȍ霘Dd*}EJ"2d=͊zZ/w_9~ q$dQ1I#㍪^cW9U舞*e,7Yf\f k'LԱu(z68GUTCdY86>[-^7=B[ ZTiU[6ٙ㍮{ܨ~Fr#Z⪤8+-Y q{q^>^1QX3E.Ms=DpS,s*lazW b#7#ͅ&6VW&oO/NMNg8WֿW6ym%Y-kŔ,#6vH7Ѩbu 6|dUaT:{̉**@'U^hEQ8R8ZiglLOrMvۏe